G1196359



Basic Information


Item Value
gene id G1196359
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 65185403 ~ 65186626 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1365198
gtctgcagagagatgtctaaatgaggtgtctaaatgaatataccacagtctgcagagaggtgtctaaatgaatataccacggtctgcagagaggtgtctaaatgaggtgtctaaatgaatataccacggtctgcagagagatgtctaaatgaggtgtctaaatgaatataccacagtctgcagagaggtgtctaaatgaatataccacggtctgcagagaggtgtctaaatgaggtgtctaaatgaatataccacggtctgcagagaggtgtctaaatgaatataccacggtctgcagagaggtgtctaaatgaatataccacggtctgcagagaggtgtctaaatgaatataccacggtctgcagagaggtgtctaaatgaggtgtctaaatgaatataccacagtctgcagagaggtgtctaaatgaatataccacggtctgcagagaggtgtctaaat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1365198 True 461 lncRNA 0.42 2 65185403 65186626

Neighbor


gene id symbol gene type direction distance location
LOC118936529 LOC105012854 coding downstream 139942 64969176 ~ 65045461 (-)
LOC110487107 LOC106606311 coding downstream 221580 64952654 ~ 64963823 (-)
LOC118938356 NA coding downstream 231179 64951543 ~ 64954224 (-)
LOC110487480 LOC106606286 coding downstream 239752 64798656 ~ 64945651 (-)
LOC110486630 LOC106601477 coding downstream 510370 64667592 ~ 64675033 (-)
LOC118938357 LOC106595583 coding upstream 301322 65487948 ~ 65503404 (-)
LOC118938101 LOC106603827 coding upstream 1033439 66220065 ~ 66267701 (-)
LOC118938102 LOC106603753 coding upstream 1038524 66225150 ~ 66385923 (-)
LOC118938480 NA coding upstream 1236971 66423597 ~ 66424229 (-)
LOC118938476 LOC106603753 coding upstream 1247763 66434389 ~ 66435647 (-)
G1196311 NA non-coding downstream 79176 65100974 ~ 65106227 (-)
G1196322 NA non-coding downstream 109347 65075726 ~ 65076056 (-)
G1196242 NA non-coding downstream 145044 65039857 ~ 65040359 (-)
G1196239 NA non-coding downstream 155372 65029192 ~ 65030031 (-)
G1196236 NA non-coding downstream 162216 65022739 ~ 65023187 (-)
G1196389 NA non-coding upstream 50041 65236667 ~ 65238604 (-)
G1196394 NA non-coding upstream 55966 65242592 ~ 65242847 (-)
G1196397 NA non-coding upstream 57983 65244609 ~ 65244842 (-)
G1196398 NA non-coding upstream 58728 65245354 ~ 65245576 (-)
G1196400 NA non-coding upstream 60074 65246700 ~ 65246937 (-)
G1196205 LOC106606311 other downstream 221618 64951790 ~ 64963785 (-)
G1196208 NA other downstream 224227 64957278 ~ 64961176 (-)
G1196113 NA other downstream 390332 64794648 ~ 64795071 (-)
G1195997 NA other downstream 708031 64476970 ~ 64477372 (-)
LOC110487482 LOC106606373 other downstream 837996 64334669 ~ 64362841 (-)
G1196409 NA other upstream 66653 65253279 ~ 65254078 (-)
G1196536 emp2 other upstream 282821 65446633 ~ 65472652 (-)
G1196797 NA other upstream 604097 65790723 ~ 65795435 (-)
G1196818 NA other upstream 671192 65857818 ~ 65859372 (-)

Expression


G1196359 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1196359 Expression in each Bioproject

Bar chart with 6 bars.
G1196359 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network