G1196551



Basic Information


Item Value
gene id G1196551
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 65485043 ~ 65485275 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1365434
ctccaggactgtggagataccagatcctttgaatagagaccatctctctccaggactgtggagttaccagaccctttgaatagagaccatctctctccaggactgtggagttaccagaccctttgaatagagactctccaggactgtggagataccagaccctttgaatagagaccatctctctccaggactgtggagttaccagaccctttgaatagagaccatctctctcc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1365434 True 233 lncRNA 0.49 1 65485043 65485275

Neighbor


gene id symbol gene type direction distance location
LOC118936529 LOC105012854 coding downstream 439582 64969176 ~ 65045461 (-)
LOC110487107 LOC106606311 coding downstream 521220 64952654 ~ 64963823 (-)
LOC118938356 NA coding downstream 530819 64951543 ~ 64954224 (-)
LOC110487480 LOC106606286 coding downstream 539392 64798656 ~ 64945651 (-)
LOC110486630 LOC106601477 coding downstream 810010 64667592 ~ 64675033 (-)
LOC118938357 LOC106595583 coding upstream 2673 65487948 ~ 65503404 (-)
LOC118938101 LOC106603827 coding upstream 734790 66220065 ~ 66267701 (-)
LOC118938102 LOC106603753 coding upstream 739875 66225150 ~ 66385923 (-)
LOC118938480 NA coding upstream 938322 66423597 ~ 66424229 (-)
LOC118938476 LOC106603753 coding upstream 949114 66434389 ~ 66435647 (-)
G1196536 emp2 non-coding downstream 15274 65446633 ~ 65472652 (-)
G1196469 NA non-coding downstream 152561 65331581 ~ 65332482 (-)
G1196467 NA non-coding downstream 158677 65326089 ~ 65326366 (-)
G1196455 NA non-coding downstream 195008 65289296 ~ 65290035 (-)
G1196419 NA non-coding downstream 217421 65267277 ~ 65267622 (-)
G1196552 NA non-coding upstream 320 65485595 ~ 65486068 (-)
G1196553 NA non-coding upstream 11046 65496321 ~ 65497084 (-)
G1196554 NA non-coding upstream 16216 65501491 ~ 65501786 (-)
G1196558 NA non-coding upstream 28821 65514096 ~ 65514332 (-)
G1196715 NA non-coding upstream 43821 65529096 ~ 65530349 (-)
G1196409 NA other downstream 230965 65253279 ~ 65254078 (-)
G1196205 LOC106606311 other downstream 521258 64951790 ~ 64963785 (-)
G1196208 NA other downstream 523867 64957278 ~ 64961176 (-)
G1196113 NA other downstream 689972 64794648 ~ 64795071 (-)
G1196797 NA other upstream 305448 65790723 ~ 65795435 (-)
G1196818 NA other upstream 372543 65857818 ~ 65859372 (-)
G1196805 NA other upstream 394951 65880226 ~ 65920222 (-)
G1196890 NA other upstream 567375 66052650 ~ 66053067 (-)

Expression


G1196551 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1196551 Expression in each Bioproject

Bar chart with 10 bars.
G1196551 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network