G1196729



Basic Information


Item Value
gene id G1196729
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 65570488 ~ 65572814 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1365675
taaacatcacagtgaaatgctgaccaaccagcccttaaccaacaggtgtaaacattacagtgaaatgctgaccaaccagcccttaaccaacaggtgtaaaaattacagtgaaatgctgaccagcccttaaccaacaggtgtagacctcacagtgaaatgctgactgaccagcccttaaccaacaggtgtaaacattacagtgaaatgctgaccgaccagccccttaaccaacaggtgtaaacattacagtgaaatgctgaccgacgagcccttaaccaacaggtgtaaacattacagtgaaatgctgaatacaacaggtgtaaacattacagtgaaatgctgaccgaccagcccttaaccaacaggtgtagacctcacagtgaaatgctgactgac
>TU1365676
gtaaacattacagtgaaatgctgaccgaccagcccttaaccaacaggtgtaaacattacagtgaaatgctgactgaccagcccttaaccaacaggtgtaaacattacagtgaaatgctgaatacaacaggtgtaaacattacagtgaaatgctgaccgaccagcccttaaccaacaggtgtagacctcacagtgaaatgctgactgac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1365675 False 396 lncRNA 0.45 2 65570488 65572288
TU1365676 True 208 lncRNA 0.44 2 65570488 65572814
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118938357 LOC106595583 coding downstream 67096 65487948 ~ 65503404 (-)
LOC118936529 LOC105012854 coding downstream 525027 64969176 ~ 65045461 (-)
LOC110487107 LOC106606311 coding downstream 606665 64952654 ~ 64963823 (-)
LOC118938356 NA coding downstream 616264 64951543 ~ 64954224 (-)
LOC110487480 LOC106606286 coding downstream 624837 64798656 ~ 64945651 (-)
LOC118938101 LOC106603827 coding upstream 647251 66220065 ~ 66267701 (-)
LOC118938102 LOC106603753 coding upstream 652336 66225150 ~ 66385923 (-)
LOC118938480 NA coding upstream 850783 66423597 ~ 66424229 (-)
LOC118938476 LOC106603753 coding upstream 861575 66434389 ~ 66435647 (-)
LOC110519882 LOC106603827 coding upstream 1104517 66677331 ~ 66679483 (-)
G1196728 NA non-coding downstream 477 65569603 ~ 65570011 (-)
G1196715 NA non-coding downstream 40139 65529096 ~ 65530349 (-)
G1196558 NA non-coding downstream 56156 65514096 ~ 65514332 (-)
G1196554 NA non-coding downstream 68702 65501491 ~ 65501786 (-)
G1196553 NA non-coding downstream 73404 65496321 ~ 65497084 (-)
G1196742 NA non-coding upstream 28836 65601650 ~ 65602052 (-)
G1196747 NA non-coding upstream 51596 65624410 ~ 65628391 (-)
G1196762 NA non-coding upstream 95909 65668723 ~ 65671791 (-)
G1196769 NA non-coding upstream 125161 65697975 ~ 65698369 (-)
G1196776 NA non-coding upstream 148151 65720965 ~ 65721310 (-)
G1196536 emp2 other downstream 97836 65446633 ~ 65472652 (-)
G1196409 NA other downstream 316410 65253279 ~ 65254078 (-)
G1196205 LOC106606311 other downstream 606703 64951790 ~ 64963785 (-)
G1196797 NA other upstream 217909 65790723 ~ 65795435 (-)
G1196818 NA other upstream 285004 65857818 ~ 65859372 (-)
G1196805 NA other upstream 307412 65880226 ~ 65920222 (-)
G1196890 NA other upstream 479836 66052650 ~ 66053067 (-)
G1197903 LOC106603827 other upstream 795242 66368056 ~ 66374151 (-)

Expression


G1196729 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1196729 Expression in each Bioproject

Bar chart with 7 bars.
G1196729 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network