G1198031



Basic Information


Item Value
gene id G1198031
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 66369112 ~ 66369770 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1367425
cacacacacacacacacacacacacactggacacacacacactggacacacacacactggacacacacacacacacacacacacacactggacacacacacactggacacacacacacactggacacacacacactggacacacacacactggacacacacacacactggacacacacacacactggacacacacacacactggacacaaacacacactggacacaaaca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1367425 True 230 lncRNA 0.52 2 66369112 66369770

Neighbor


gene id symbol gene type direction distance location
LOC118938101 LOC106603827 coding downstream 146206 66220065 ~ 66267701 (-)
LOC118938357 LOC106595583 coding downstream 865720 65487948 ~ 65503404 (-)
LOC118936529 LOC105012854 coding downstream 1323651 64969176 ~ 65045461 (-)
LOC110487107 LOC106606311 coding downstream 1405289 64952654 ~ 64963823 (-)
LOC118938356 NA coding downstream 1414888 64951543 ~ 64954224 (-)
LOC118938480 NA coding upstream 53827 66423597 ~ 66424229 (-)
LOC118938476 LOC106603753 coding upstream 64619 66434389 ~ 66435647 (-)
LOC110519882 LOC106603827 coding upstream 307561 66677331 ~ 66679483 (-)
LOC118938475 LOC106603827 coding upstream 382022 66751792 ~ 66775949 (-)
LOC110513226 LOC106606280 coding upstream 417676 66787446 ~ 66789545 (-)
G1198021 NA non-coding downstream 13528 66354620 ~ 66355584 (-)
G1198008 NA non-coding downstream 39974 66286275 ~ 66329138 (-)
G1198013 NA non-coding downstream 57234 66311088 ~ 66311878 (-)
G1198012 NA non-coding downstream 58836 66309722 ~ 66310276 (-)
G1198006 NA non-coding downstream 81750 66285466 ~ 66287362 (-)
G1198033 NA non-coding upstream 19484 66389254 ~ 66389646 (-)
G1198034 NA non-coding upstream 23687 66393457 ~ 66398456 (-)
G1198035 NA non-coding upstream 30570 66400340 ~ 66401076 (-)
G1198037 NA non-coding upstream 39531 66409301 ~ 66411467 (-)
G1198042 NA non-coding upstream 46959 66416729 ~ 66493975 (-)
G1196890 NA other downstream 316045 66052650 ~ 66053067 (-)
G1196805 NA other downstream 483507 65880226 ~ 65920222 (-)
G1196818 NA other downstream 509740 65857818 ~ 65859372 (-)
G1196797 NA other downstream 573677 65790723 ~ 65795435 (-)
G1198140 NA other upstream 424053 66793823 ~ 66852622 (-)
G1198179 NA other upstream 560719 66930489 ~ 66936294 (-)
LOC118938487 LOC106581592 other upstream 643220 66997539 ~ 67015258 (-)
G1198220 NA other upstream 720973 67090743 ~ 67092643 (-)
LOC110512204 LOC106592354 other upstream 801969 67167944 ~ 67175825 (-)

Expression


G1198031 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G1198031 Expression in each Bioproject

Bar chart with 21 bars.
G1198031 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network