G1198052



Basic Information


Item Value
gene id G1198052
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 66457089 ~ 66510561 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1367456
gaaatgtgttgttttacagggtcagtcatagtagtatgataggtgttgttttacagggtcatagtagtatgataggtgttgttttacagggtccgtcatagtagtatgataggtgttgttttatagggtcatagtagtatgataggtgttgttttaaagggtcatagtagtatgataggtgttgttttacagggtcagtcatagtagtatgataggtgttgttgtacagggtcagtaatagtagtatgataggtgttgttgtacagggccagacatagtagtatgataggtgttgttgtacag
>TU1367457
gaaatgtgttgttttacagggtcagtcatagtagtatgataggtgttgttttacagggtcatagtagtatgataggtgttgttttacagggtccgtcatagtagtatgataggtgttgttttatagggtcatagtagtatgataggtgttgttttaaagggtcatagtagtatgataggtgttgttttaaagggtcatagtagtatgataggtgttgttttacagggtcagtcatagtagtatgataggtgttgttgtacagggtcagtaatagtagtatgataggtgttgttgtacagggccagacatagtagtatgataggtgttgttgtacag
>TU1367458
gaaatgtgttgttttacagggtcagtcatagtagtatgataggtgttgttttacagggtcatagtagtatgataggtgttgttttacagggtccgtcatagtagtatgataggtgttgttttatagggtcatagtagtatgataggtgttgttttaaagggtcatagtagtatgataggtgttgttgtacagggtcagtcatagtagtatgataggtgttgttttacagggtcagtcatagtagtatgataggtgttgttttatagggtcatagtagtatgataggtgttgttttacagggtcagtcatagtagtatgataggtgttgttgtacagggtcagccatagtagtatgataggtggtGTTGTACAGGgtcgtagtagtatgataggtgttgttgtacagggtcgtagtagtatggtaggtgttgttgtacagggtcgtagtagtatgataggtgttgttgtacagggtcagtcatagtagtatgataggtgttgttgtacagggtcgtagtagtatgataggtgttgttgtac
>TU1367459
CTCTTCTCTAAgaatgataggtgttgttgtacagggtcatagtagtatgataggtgttgttttaaagggtcatagtagtatgataggtgttgttttacagggtccgtcatagtagtatgataggtgttgttttatagggtcatagtagtatgataggtgttgttttaaagggtcatagtagtatgataggtgttgttttacagggtcagtcatagtagtatgataggtgttgttgtacagggtcagccatagtagtatgataggtgttgttgtacagggtcagccatagtagtatgataggtgttgttgtacagggtcagtcatagtagtatgat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1367456 False 303 lncRNA 0.38 3 66457089 66510561
TU1367457 False 336 lncRNA 0.37 3 66457089 66510561
TU1367458 False 540 lncRNA 0.39 5 66457698 66510561
TU1367459 True 335 lncRNA 0.38 3 66457885 66458815

Neighbor


gene id symbol gene type direction distance location
LOC118938476 LOC106603753 coding downstream 21442 66434389 ~ 66435647 (-)
LOC118938480 NA coding downstream 32860 66423597 ~ 66424229 (-)
LOC118938102 LOC106603753 coding downstream 71166 66225150 ~ 66385923 (-)
LOC118938101 LOC106603827 coding downstream 234183 66220065 ~ 66267701 (-)
LOC118938357 LOC106595583 coding downstream 953697 65487948 ~ 65503404 (-)
LOC110519882 LOC106603827 coding upstream 166770 66677331 ~ 66679483 (-)
LOC118938475 LOC106603827 coding upstream 241231 66751792 ~ 66775949 (-)
LOC110513226 LOC106606280 coding upstream 276885 66787446 ~ 66789545 (-)
LOC118938487 LOC106581592 coding upstream 486978 66997539 ~ 67015258 (-)
LOC118938482 LOC106603827 coding upstream 654206 67164767 ~ 67166137 (-)
G1197992 NA non-coding downstream 9249 66446763 ~ 66447840 (-)
G1198045 NA non-coding downstream 18245 66437965 ~ 66438844 (-)
G1198044 NA non-coding downstream 25826 66430381 ~ 66431263 (-)
G1197896 LOC106577477 non-coding downstream 27778 66428683 ~ 66429311 (-)
G1198037 NA non-coding downstream 45622 66409301 ~ 66411467 (-)
G1198068 NA non-coding upstream 32665 66543226 ~ 66940722 (-)
G1198011 NA non-coding upstream 47926 66558487 ~ 66562888 (-)
G1198077 NA non-coding upstream 62132 66572693 ~ 66573406 (-)
G1197863 NA non-coding upstream 79104 66589665 ~ 66670054 (-)
G1198083 NA non-coding upstream 86048 66596609 ~ 66597181 (-)
G1197903 LOC106603827 other downstream 82938 66368056 ~ 66374151 (-)
G1196890 NA other downstream 404022 66052650 ~ 66053067 (-)
G1196805 NA other downstream 571484 65880226 ~ 65920222 (-)
G1196818 NA other downstream 597717 65857818 ~ 65859372 (-)
G1196797 NA other downstream 661654 65790723 ~ 65795435 (-)
G1198140 NA other upstream 283262 66793823 ~ 66852622 (-)
G1198179 NA other upstream 419928 66930489 ~ 66936294 (-)
G1198220 NA other upstream 580182 67090743 ~ 67092643 (-)
LOC110512204 LOC106592354 other upstream 661178 67167944 ~ 67175825 (-)

Expression


G1198052 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1198052 Expression in each Bioproject

Bar chart with 15 bars.
G1198052 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network