G1199133



Basic Information


Item Value
gene id G1199133
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 69150692 ~ 69151024 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1368986
TACCCCCCATAGCGTGTAGTCTTCTAGCCCCCATAGCGTGTAGTCTTCTAGCCCCCATAGCGTGTAGTCTTCAAGCCACCATAGCATATATTCTTCTAGCCCCGTAGCGTGTAGTCTTCTAGCTCCGTAGCATGTAGTCTTCTAGCCCCCGTAGCGTGTAGTCTTCTAGCCACCATAGCATGTATTCTTCTAGCCCCGTAGCGTGTAGTCTTCTAGCCCCCGTAGCGTGTAGTCTTCTAGCCACCACAGCATGTATTCTTCTAGCCACCATAGCGTGTAGTCTTCTAGCCCCCGTAGCGTGTAGTCTTCTAGCCCCGTAGCGTGTAGTCTTCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1368986 True 333 lncRNA 0.52 1 69150692 69151024

Neighbor


gene id symbol gene type direction distance location
zgc:103625 LOC106606248 coding downstream 52092 69091435 ~ 69098854 (-)
LOC110538856 LOC106606365 coding downstream 161471 68976136 ~ 68989221 (-)
LOC110538842 LOC105006167 coding downstream 213479 68865363 ~ 68937213 (-)
kt3k LOC106601911 coding downstream 289248 68856782 ~ 68861444 (-)
LOC110512740 tbcd coding downstream 294635 68714189 ~ 68856057 (-)
LOC118938362 LOC106602015 coding upstream 384324 69535348 ~ 69538421 (-)
LOC110518542 LOC105006040 coding upstream 387513 69538537 ~ 69671764 (-)
LOC110487134 smim22 coding upstream 673072 69823493 ~ 69828631 (-)
LOC118938364 LOC105012791 coding upstream 727660 69878684 ~ 69909395 (-)
LOC110485326 LOC106594247 coding upstream 815639 69966663 ~ 69979491 (-)
G1199132 NA non-coding downstream 813 69147247 ~ 69149879 (-)
G1199131 NA non-coding downstream 10452 69139891 ~ 69140240 (-)
G1199105 NA non-coding downstream 50357 69100114 ~ 69100335 (-)
G1199095 hgs non-coding downstream 72732 69071718 ~ 69077960 (-)
G1199135 NA non-coding upstream 2682 69153706 ~ 69153907 (-)
G1199136 NA non-coding upstream 2955 69153979 ~ 69162789 (-)
G1199142 NA non-coding upstream 17522 69168546 ~ 69168786 (-)
G1199149 NA non-coding upstream 61980 69213004 ~ 69220972 (-)
G1199151 NA non-coding upstream 63232 69214256 ~ 69222367 (-)
G1199087 NA other downstream 87815 69060096 ~ 69062877 (-)
G1199049 NA other downstream 156264 68993691 ~ 68994428 (-)
G1199170 NA other upstream 118982 69270006 ~ 69275774 (-)
G1199205 NA other upstream 201457 69352481 ~ 69353948 (-)
G1199212 NA other upstream 212643 69363667 ~ 69366223 (-)
G1199912 LOC105012792 other upstream 773845 69924869 ~ 69925550 (-)

Expression


G1199133 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1199133 Expression in each Bioproject

Bar chart with 9 bars.
G1199133 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network