G1200105



Basic Information


Item Value
gene id G1200105
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 70371323 ~ 70371853 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1370422
TTACAATAGAAGGTGATGTCTGAGTGAAGTTGTACCTGTTGTACCTGTCATTACAATAGAAGGTGATGTCTGAGTGAAGTTGTACCTGTCATTACAGTAGAAGGTGATGTCTGAGTGAAGTTGTACCTGTCATTACAGTAGAAGGTGATGTCTGAGTGAAGTTGTACCTGTCATTACAGTAGAAGGTGATGTCTGAGTGAAGTTGTACCTGTTGTACCTGTCATTACAGTAGAAGGTGATGTCTGAGTGAAGCTGTACCTGTTGTACCTGTCATTACAGTAGAAGGTGATGTCTGAGTGAAGTTGTACCTGTCATTACAATAGAAGGTGATGTCTGAGTGAAGTTGTACCTGTTGTACCTGTCATTACAATAGAAGGTGATGTCTGAGTGAAGTTGTACCTGTCATTACAGTAGAAGGTGATGTCTGAGTGAAGTTGTACCTGTCATTACAGTAGAAGGTGATGTCTGAGTGAAGTTGTACCTGTTGTAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1370422 True 490 lncRNA 0.41 2 70371323 70371853
Loading

Neighbor


gene id symbol gene type direction distance location
scpep1 LOC106602055 coding downstream 64583 70289977 ~ 70306740 (-)
LOC110485314 LOC105031325 coding downstream 115333 70175518 ~ 70255990 (-)
LOC110487094 dus1l coding downstream 228210 70120183 ~ 70143113 (-)
zgc:86896 LOC106606197 coding downstream 328795 70029544 ~ 70042528 (-)
LOC110487114 LOC106594630 coding downstream 351400 69984886 ~ 70019923 (-)
trnat-cgu-6 NA coding upstream 83361 70455214 ~ 70455285 (-)
crlf3 LOC106601961 coding upstream 137989 70509842 ~ 70549487 (-)
LOC110538801 LOC106594817 coding upstream 203681 70575156 ~ 70578123 (-)
LOC110539049 LOC106606315 coding upstream 258557 70630124 ~ 70706867 (-)
LOC110514604 NA coding upstream 410662 70782515 ~ 70785643 (-)
G1200084 NA non-coding downstream 38873 70331104 ~ 70332450 (-)
G1200075 NA non-coding downstream 57719 70312596 ~ 70313604 (-)
G1200070 NA non-coding downstream 85793 70284902 ~ 70285530 (-)
G1200066 NA non-coding downstream 91532 70279441 ~ 70279791 (-)
G1200110 NA non-coding upstream 22824 70394677 ~ 70397929 (-)
G1200120 LOC106606268 non-coding upstream 40610 70412463 ~ 70416099 (-)
G1200115 NA non-coding upstream 49781 70421634 ~ 70472608 (-)
G1200125 NA non-coding upstream 55450 70427303 ~ 70428757 (-)
G1200132 NA non-coding upstream 66271 70438124 ~ 70439258 (-)
G1199973 NA other downstream 203406 70165996 ~ 70167917 (-)
G1200016 LOC105899958 other downstream 263808 70094095 ~ 70107515 (-)
G1200003 NA other downstream 301064 70069825 ~ 70070259 (-)
G1199912 LOC105012792 other downstream 445773 69924869 ~ 69925550 (-)
LOC110487134 smim22 other downstream 543219 69823493 ~ 69828631 (-)
G1200151 NA other upstream 92691 70464544 ~ 70509167 (-)
G1200257 NA other upstream 403589 70775442 ~ 70775785 (-)
G1200282 LOC106602018 other upstream 500795 70831382 ~ 70907457 (-)
G1200341 NA other upstream 660375 71032228 ~ 71033069 (-)
G1200504 NA other upstream 778604 71150457 ~ 71154771 (-)

Expression


G1200105 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1200105 Expression in each Bioproject

Bar chart with 5 bars.
G1200105 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network