G1199618



Basic Information


Item Value
gene id G1199618
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 70490752 ~ 70491983 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1369727
ggctaagtggggagctaacatgatacagtccagactcccagtacaggctaagtggggagctaacatgatacagtccagactcccagtacaggctgagtggagagctaacatgatacagtccagactcccagtggaggctaagtggggagctaacatgatacagtccagactcccagtacaggctaagtggggagctaacatgatacagtccagactcccagtacaggatgagtggagagctaacatgatacagtccagactcccagtacaggctgagtggggagctaacatgatacagtacaggctaagtggagagctaacatgatacagtacaggctaagtggggagctaacatgatacagtacaggctaagtggggagctaac

Function


NR:

description
uncharacterized protein LOC110510599

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1369727 True 385 TUCP 0.50 2 70490752 70491983

Neighbor


gene id symbol gene type direction distance location
LOC110538806 NA coding upstream 29395 70455689 ~ 70461357 (+)
LOC118938367 LOC106606268 coding upstream 71062 70321429 ~ 70419690 (+)
LOC118938106 LOC106602057 coding upstream 169751 70311372 ~ 70321001 (+)
LOC110539075 engase coding upstream 200972 70266550 ~ 70289780 (+)
LOC110487092 LOC105031326 coding upstream 323028 70155053 ~ 70167724 (+)
LOC110538810 LOC106602038 coding downstream 59986 70551969 ~ 70559055 (+)
LOC110538798 LOC106601995 coding downstream 87447 70579430 ~ 70591367 (+)
LOC110539051 LOC106606316 coding downstream 113135 70605118 ~ 70624736 (+)
LOC118938368 NA coding downstream 132880 70624863 ~ 70630060 (+)
LOC110515631 LOC106601999 coding downstream 222892 70714875 ~ 70782765 (+)
G1199603 NA non-coding upstream 47205 70442734 ~ 70443547 (+)
G1199601 NA non-coding upstream 53675 70435380 ~ 70437077 (+)
G1199588 NA non-coding upstream 68349 70420171 ~ 70422403 (+)
G1199586 NA non-coding upstream 89137 70401183 ~ 70401615 (+)
G1199626 NA non-coding downstream 40306 70532289 ~ 70545317 (+)
G1199632 NA non-coding downstream 48250 70540233 ~ 70542030 (+)
G1199645 NA non-coding downstream 63036 70555019 ~ 70556785 (+)
G1199637 NA non-coding downstream 67410 70559393 ~ 70560898 (+)
G1199648 NA non-coding downstream 73718 70565701 ~ 70565979 (+)
LOC118938366 NA other upstream 404591 70080997 ~ 70086161 (+)
LOC110485310 LOC106535622 other upstream 409880 70068170 ~ 70080888 (+)
LOC110485311 LOC106606205 other upstream 440020 70044341 ~ 70063866 (+)
LOC110487135 rogdi other upstream 670494 69801336 ~ 69821081 (+)
G1198885 LOC100194703 other upstream 1316656 69173581 ~ 69174096 (+)
G1199589 LOC106606316 other downstream 113154 70605137 ~ 70627178 (+)
G1200355 NA other downstream 661621 71153604 ~ 71154711 (+)
LOC118936530 fa86a other downstream 1161208 71652973 ~ 71657389 (+)
G1200756 NA other downstream 1241212 71733195 ~ 71743181 (+)
LOC118938376 LOC106597406 other downstream 1353580 71845013 ~ 71891083 (+)

Expression


G1199618 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1199618 Expression in each Bioproject

Bar chart with 19 bars.
G1199618 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network