G1201462



Basic Information


Item Value
gene id G1201462
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 72271439 ~ 72271748 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1372374
gagacagacacctcatagtggattcaccctgactgagagacaacatcaggcaccacatagtggattcaccctgactgagagacaacatcagacatctcatagtggattcaccctgactgagagacaacatcagacaccacatagtggattcaccctgactgagagacaacatcagacacctcatagtggattcaccctgacttagacatcagacacctcatagtggattcaccctgactgagagacaacatcagacaccacatagtggattcaccctgactgagagacaacatcagacactatatagtgg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1372374 True 310 lncRNA 0.47 1 72271439 72271748

Neighbor


gene id symbol gene type direction distance location
LOC118938108 NA coding downstream 65457 72201402 ~ 72205982 (-)
LOC118938378 sept12 coding downstream 108012 71981149 ~ 72163427 (-)
LOC118938107 NA coding downstream 290165 71978726 ~ 71981274 (-)
LOC110494397 LOC106596483 coding downstream 543300 71690864 ~ 71728139 (-)
LOC110494400 alg1 coding downstream 598894 71657600 ~ 71672545 (-)
LOC110517414 tmem114 coding upstream 474996 72746744 ~ 72796030 (-)
LOC110512991 LOC106592621 coding upstream 635298 72907046 ~ 72934615 (-)
LOC118938382 NA coding upstream 673162 72940912 ~ 72948496 (-)
LOC118938383 natu coding upstream 678977 72950725 ~ 72971489 (-)
LOC110487136 LOC106596253 coding upstream 729155 73000903 ~ 73014178 (-)
G1201451 NA non-coding downstream 36991 72234175 ~ 72234448 (-)
G1201445 NA non-coding downstream 62432 72207954 ~ 72209007 (-)
G1201105 NA non-coding downstream 76275 72188999 ~ 72195164 (-)
G1201097 NA non-coding downstream 87015 72182793 ~ 72184424 (-)
G1201094 NA non-coding downstream 91166 72179935 ~ 72180273 (-)
G1201468 NA non-coding upstream 18438 72290186 ~ 72291311 (-)
G1201473 NA non-coding upstream 42092 72313840 ~ 72314600 (-)
G1201476 NA non-coding upstream 47625 72319373 ~ 72319726 (-)
G1201478 NA non-coding upstream 51938 72323686 ~ 72323942 (-)
G1201482 NA non-coding upstream 66833 72338581 ~ 72338786 (-)
G1201088 NA other downstream 118939 72152114 ~ 72152500 (-)
G1200789 NA other downstream 527464 71741161 ~ 71743975 (-)
G1200790 NA other downstream 536855 71733297 ~ 71734584 (-)
G1201587 NA other upstream 398415 72670163 ~ 72671927 (-)
G1201668 NA other upstream 676833 72948581 ~ 72949745 (-)
G1201724 NA other upstream 705555 72977303 ~ 72977759 (-)
LOC110487137 LOC106606270 other upstream 756719 73017755 ~ 73030221 (-)

Expression


G1201462 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1201462 Expression in each Bioproject

Bar chart with 3 bars.
G1201462 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.

Co-expression Network