G1201492



Basic Information


Item Value
gene id G1201492
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 72377444 ~ 72377865 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1372417
gttataactacacacagtcatgttataactacacacagtcatgttataactacacacagtcatgttataactacacacagtcatgttataactacacaacagtcatgttataactacacacagtcatgttataactacacaacacacagtcatgttataactacacaacagtcatgttataactacacacagtcatgttataactacacacagtcatgttataactacacacagtcatgttataactacacacagtcatgttataactaactacacacagtcatgttataactaactacac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1372417 True 301 lncRNA 0.33 2 72377444 72377865

Neighbor


gene id symbol gene type direction distance location
LOC118938108 NA coding downstream 171462 72201402 ~ 72205982 (-)
LOC118938378 sept12 coding downstream 214017 71981149 ~ 72163427 (-)
LOC118938107 NA coding downstream 396170 71978726 ~ 71981274 (-)
LOC110494397 LOC106596483 coding downstream 649305 71690864 ~ 71728139 (-)
LOC110494400 alg1 coding downstream 704899 71657600 ~ 71672545 (-)
LOC110517414 tmem114 coding upstream 368879 72746744 ~ 72796030 (-)
LOC110512991 LOC106592621 coding upstream 529181 72907046 ~ 72934615 (-)
LOC118938382 NA coding upstream 567045 72940912 ~ 72948496 (-)
LOC118938383 natu coding upstream 572860 72950725 ~ 72971489 (-)
LOC110487136 LOC106596253 coding upstream 623038 73000903 ~ 73014178 (-)
G1201488 NA non-coding downstream 11859 72364492 ~ 72365585 (-)
G1201484 NA non-coding downstream 26388 72350845 ~ 72351056 (-)
G1201482 NA non-coding downstream 38658 72338581 ~ 72338786 (-)
G1201478 NA non-coding downstream 53502 72323686 ~ 72323942 (-)
G1201476 NA non-coding downstream 57718 72319373 ~ 72319726 (-)
G1201496 NA non-coding upstream 13926 72391791 ~ 72392154 (-)
G1201510 NA non-coding upstream 47466 72425331 ~ 72466822 (-)
G1201523 NA non-coding upstream 107132 72484997 ~ 72485370 (-)
G1201530 NA non-coding upstream 128860 72506725 ~ 72898511 (-)
G1201532 NA non-coding upstream 128933 72506798 ~ 72540312 (-)
G1201088 NA other downstream 224944 72152114 ~ 72152500 (-)
G1200789 NA other downstream 633469 71741161 ~ 71743975 (-)
G1200790 NA other downstream 642860 71733297 ~ 71734584 (-)
G1201587 NA other upstream 292298 72670163 ~ 72671927 (-)
G1201668 NA other upstream 570716 72948581 ~ 72949745 (-)
G1201724 NA other upstream 599438 72977303 ~ 72977759 (-)
LOC110487137 LOC106606270 other upstream 650602 73017755 ~ 73030221 (-)

Expression


G1201492 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1201492 Expression in each Bioproject

Bar chart with 2 bars.
G1201492 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network