LOC118938777



Basic Information


Item Value
gene id LOC118938777
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 37800072 ~ 37800148 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005036034.1
ATGCAATGATGTTTTGAATTTCTTCACCTGAAATAATCATGAAGTTTTTTTTATTGAGCTTTTTAACCCTGAGCATC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005036034.1 True 77 mRNA 0.30 1 37800072 37800148

Neighbor


gene id symbol gene type direction distance location
LOC110489227 NA coding downstream 54834 37700820 ~ 37745238 (-)
LOC110489226 LOC106604165 coding downstream 111899 37641854 ~ 37688173 (-)
LOC110510782 mid2 coding downstream 1420810 36145477 ~ 36379262 (-)
LOC110489193 peam3 coding downstream 1725970 36043082 ~ 36074102 (-)
LOC110489191 LOC106604152 coding downstream 1822305 35943307 ~ 35977767 (-)
rpb7 rpb7 coding upstream 3440 37803588 ~ 37810500 (-)
LOC118938731 NA coding upstream 10521 37810669 ~ 37825003 (-)
LOC110489484 LOC106604167 coding upstream 260217 38060365 ~ 38069359 (-)
LOC110489233 ctnna1 coding upstream 943942 38744090 ~ 38968665 (-)
LOC118938733 NA coding upstream 946876 38747024 ~ 38748988 (-)
G1243666 NA non-coding downstream 17959 37781863 ~ 37782113 (-)
G1243722 NA non-coding downstream 18653 37781154 ~ 37781419 (-)
G1243706 NA non-coding downstream 45089 37754588 ~ 37754983 (-)
G1243705 NA non-coding downstream 45925 37753923 ~ 37754147 (-)
G1243704 NA non-coding downstream 46473 37753145 ~ 37753599 (-)
G1243751 NA non-coding upstream 99455 37899603 ~ 37900006 (-)
G1243752 NA non-coding upstream 99934 37900082 ~ 37904820 (-)
G1243775 NA non-coding upstream 151348 37951496 ~ 37951829 (-)
G1243779 NA non-coding upstream 165678 37965826 ~ 37966229 (-)
G1243758 NA non-coding upstream 187457 37987605 ~ 37990303 (-)
G1243718 NA other downstream 26802 37772631 ~ 37773270 (-)
G1243234 NA other downstream 353862 37445769 ~ 37446210 (-)
G1242169 NA other downstream 1381997 36415978 ~ 36418075 (-)
matr3l1.1 LOC106604139 other downstream 2211079 35578460 ~ 35589383 (-)
G1241697 NA other downstream 2280742 35517777 ~ 35519330 (-)
G1244197 NA other upstream 700539 38500687 ~ 38500999 (-)
G1244755 LOC106604128 other upstream 1049498 38824503 ~ 38852543 (-)
G1244972 rnf44 other upstream 1485506 39285654 ~ 39298246 (-)
G1245005 NA other upstream 1622711 39422859 ~ 39424565 (-)
G1246021 NA other upstream 2868427 40668575 ~ 40669571 (-)

Expression


LOC118938777 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

LOC118938777 Expression in each Bioproject

Bar chart with 2 bars.
LOC118938777 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.
End of interactive chart.

Co-expression Network