G1203538



Basic Information


Item Value
gene id G1203538
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 1420094 ~ 1420427 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1374832
gtattattagtattggatagaaaacactctaaagtttccaaaactgtcaaaatattttctgtgagtataacagaactgatattgcaggcgaaacccagaggaaaaacaaaacaggaagtggcctctattttgaaaactccatgttctatagcctccctttgctccatttaacctcttgaacctctgggggcagtatttcatttttggatgaaaaactttcccgttttaagcgcaatattttgtcacgaaaagatgctcgactatgcatataattgacggctttggaaagaaaacactctgacgtttccaaatctgcaaagatattgtctgtgag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1374832 True 334 lncRNA 0.37 1 1420094 1420427

Neighbor


gene id symbol gene type direction distance location
LOC110488541 LOC106604901 coding downstream 525364 886467 ~ 894730 (-)
LOC110488540 LOC106604900 coding downstream 561076 856007 ~ 859018 (-)
LOC110488539 LOC106604899 coding downstream 564546 787797 ~ 855548 (-)
LOC110488494 LOC106604973 coding downstream 718082 688217 ~ 702012 (-)
LOC118938771 NA coding downstream 766759 650728 ~ 653335 (-)
LOC110488543 LOC106604962 coding upstream 90616 1511043 ~ 1517122 (-)
LOC118938747 ids coding upstream 1164112 2584539 ~ 2592077 (-)
LOC110487696 ids coding upstream 1179453 2599880 ~ 2607421 (-)
LOC110488549 lonrf3 coding upstream 1287445 2707872 ~ 2718786 (-)
LOC110489459 NA coding upstream 1319802 2740229 ~ 2742064 (-)
G1203529 NA non-coding downstream 6611 1413256 ~ 1413483 (-)
G1203459 NA non-coding downstream 51468 1368415 ~ 1368626 (-)
G1203356 NA non-coding downstream 76940 1277810 ~ 1343154 (-)
G1203260 NA non-coding downstream 176485 1243403 ~ 1243609 (-)
G1203176 NA non-coding downstream 230227 1189389 ~ 1189867 (-)
G1203544 NA non-coding upstream 2422 1422849 ~ 1423109 (-)
G1203564 NA non-coding upstream 16135 1436562 ~ 1436782 (-)
G1203569 NA non-coding upstream 18389 1438816 ~ 1439042 (-)
G1203570 NA non-coding upstream 18652 1439079 ~ 1439291 (-)
G1203666 NA non-coding upstream 54273 1474700 ~ 1474907 (-)
G1202426 NA other downstream 815564 603006 ~ 604530 (-)
G1205002 NA other upstream 1088484 2508911 ~ 2509412 (-)
G1205223 LOC100136420 other upstream 1193565 2613992 ~ 2660983 (-)
G1206283 LOC106604946 other upstream 2028654 3449081 ~ 3451129 (-)
G1206291 fbxo38 other upstream 2046636 3467063 ~ 3467669 (-)
G1206357 LOC106604937 other upstream 2190376 3610803 ~ 3612293 (-)

Expression


G1203538 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1203538 Expression in each Bioproject

Bar chart with 17 bars.
G1203538 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network