G1206826



Basic Information


Item Value
gene id G1206826
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 4255212 ~ 4255424 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1378349
gactggaggccgtcgctggaggccccggactggggaccctcgctggaggctccggactggaggccgtcgctggaggctccggactggaggccgtcgctagaggctccggactggagaccgtcgctggaggctccggactggagaccgtctctggaggcttcgtgccatggatcatcactggaggcttcatgccatggatcatcactggaggct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1378349 True 213 lncRNA 0.67 1 4255212 4255424

Neighbor


gene id symbol gene type direction distance location
LOC110488579 LOC100136477 coding upstream 20804 4167628 ~ 4234408 (+)
LOC110488578 LOC106604931 coding upstream 126069 4100421 ~ 4129143 (+)
casp casp coding upstream 428359 3811379 ~ 3826853 (+)
LOC110488574 LOC106604937 coding upstream 611794 3606916 ~ 3643418 (+)
roa0 roa0 coding upstream 648652 3597238 ~ 3606560 (+)
LOC110488580 slc26a2 coding downstream 457 4255881 ~ 4270729 (+)
LOC110489462 NA coding downstream 30186 4285610 ~ 4288769 (+)
LOC110488581 LOC106611927 coding downstream 72122 4327546 ~ 4477610 (+)
LOC110488584 NA coding downstream 114748 4370172 ~ 4371370 (+)
LOC110488586 LOC106604927 coding downstream 381170 4636594 ~ 4643947 (+)
G1206794 NA non-coding upstream 102460 4152539 ~ 4152752 (+)
G1206767 NA non-coding upstream 153725 4101285 ~ 4101487 (+)
G1206490 NA non-coding upstream 376230 3878656 ~ 3878982 (+)
G1206401 NA non-coding upstream 510605 3744373 ~ 3744607 (+)
G1206834 NA non-coding downstream 10721 4266145 ~ 4266404 (+)
G1206840 NA non-coding downstream 21399 4276823 ~ 4277062 (+)
G1206849 NA non-coding downstream 34388 4289812 ~ 4290076 (+)
G1207045 NA non-coding downstream 131349 4386773 ~ 4389477 (+)
G1207056 NA non-coding downstream 148557 4403981 ~ 4404212 (+)
G1205631 LOC106611372 other upstream 1079982 3174502 ~ 3175230 (+)
LOC110488551 LOC106604955 other upstream 1102479 2837214 ~ 3160873 (+)
G1202826 NA other upstream 3314038 940502 ~ 941174 (+)
si:ch211-255i20.3 LOC106604974 other upstream 3494518 750392 ~ 760694 (+)
G1207553 NA other downstream 666717 4922141 ~ 4922560 (+)
G1208884 NA other downstream 1648497 5903921 ~ 5907769 (+)
G1209615 LOC106604863 other downstream 2488510 6743934 ~ 6744790 (+)
G1209622 NA other downstream 2495928 6751352 ~ 6751714 (+)

Expression


G1206826 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1206826 Expression in each Bioproject

Bar chart with 12 bars.
G1206826 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network