G1208273



Basic Information


Item Value
gene id G1208273
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 4792571 ~ 4792809 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1379895
gggtggcgcagtggttaagggcgctgtactgcagcgccagctgtgccatcagagtccctgggttcgtgcccaggctctgtcgtaacaggccgtgaccgggagatccgtggggcgacgcacaattggcctagcgtcgtccgggttagggagggcttggtcggtagggatgtccttgtctcatcgcgcaccagcgactcctgtggcaggccgggcgcagtgcgcgctaaccaaggttgcca

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1379895 True 239 lncRNA 0.65 1 4792571 4792809

Neighbor


gene id symbol gene type direction distance location
egr1 LOC106604926 coding downstream 98145 4690035 ~ 4694426 (-)
LOC100136712 LOC106604929 coding downstream 224704 4531744 ~ 4567867 (-)
LOC110487697 NA coding downstream 280636 4511221 ~ 4511935 (-)
LOC110489461 pde6a coding downstream 537857 4237602 ~ 4254714 (-)
LOC110488577 LOC106604933 coding downstream 742365 3839332 ~ 4050206 (-)
reep2 LOC106604925 coding upstream 34732 4827541 ~ 4860434 (-)
LOC110488590 LOC106604924 coding upstream 68345 4861154 ~ 4880515 (-)
LOC110488591 LOC106604923 coding upstream 89011 4881820 ~ 4892772 (-)
LOC110488592 LOC106604922 coding upstream 106718 4899527 ~ 4922510 (-)
LOC110488595 LOC106604921 coding upstream 137671 4930480 ~ 4937028 (-)
G1208247 NA non-coding downstream 35181 4757174 ~ 4757390 (-)
G1208241 NA non-coding downstream 46195 4746170 ~ 4746376 (-)
G1208229 NA non-coding downstream 54712 4737637 ~ 4737859 (-)
G1208227 NA non-coding downstream 57850 4734469 ~ 4734721 (-)
G1208222 NA non-coding downstream 61645 4730622 ~ 4730926 (-)
G1208314 NA non-coding upstream 102690 4895499 ~ 4895724 (-)
G1208321 NA non-coding upstream 124125 4916934 ~ 4917174 (-)
G1208324 NA non-coding upstream 127681 4920490 ~ 4920693 (-)
LOC110488599 LOC106604914 non-coding upstream 189524 4982188 ~ 5198387 (-)
G1208516 NA non-coding upstream 524125 5316934 ~ 5317603 (-)
G1206939 LOC100136477 other downstream 566602 4225039 ~ 4225969 (-)
LOC110488575 LOC106604935 other downstream 1058625 3728495 ~ 3733973 (-)
G1206357 LOC106604937 other downstream 1180278 3610803 ~ 3612293 (-)
G1206291 fbxo38 other downstream 1324902 3467063 ~ 3467669 (-)
G1206283 LOC106604946 other downstream 1341442 3449081 ~ 3451129 (-)
LOC110489463 LOC106601388 other upstream 748370 5541035 ~ 5542569 (-)
G1208831 NA other upstream 1073513 5866322 ~ 5866950 (-)
G1209268 NA other upstream 1346551 6139360 ~ 6140037 (-)
G1209275 LOC106604892 other upstream 1353137 6145946 ~ 6150661 (-)

Expression


G1208273 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1208273 Expression in each Bioproject

Bar chart with 18 bars.
G1208273 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network