G1208321



Basic Information


Item Value
gene id G1208321
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 4916934 ~ 4917174 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1379943
ctctcacaccatgagaaacaagattctatggtctgaaatcaagatagaactatttggcctgaatgccaaacgtcacaaagatgaacggagcaaagtacagagagatccttgatgaaaacattctccagagcgctcaggacctcagacttgggcgaaggttcaccttccaacaggacaacgaccctaagcacacagtcaagacaacgcaggaatggcttcgggacaagtctctgaataaatg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1379943 True 241 lncRNA 0.46 1 4916934 4917174
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110488591 LOC106604923 coding downstream 24162 4881820 ~ 4892772 (-)
LOC110488590 LOC106604924 coding downstream 36419 4861154 ~ 4880515 (-)
reep2 LOC106604925 coding downstream 56500 4827541 ~ 4860434 (-)
egr1 LOC106604926 coding downstream 222508 4690035 ~ 4694426 (-)
LOC100136712 LOC106604929 coding downstream 349067 4531744 ~ 4567867 (-)
LOC110488595 LOC106604921 coding upstream 13306 4930480 ~ 4937028 (-)
LOC110488598 LOC100194681 coding upstream 46193 4963367 ~ 4969132 (-)
LOC100136700 LOC106604916 coding upstream 60716 4977890 ~ 4981528 (-)
LOC110488599 LOC106604914 coding upstream 65014 4982188 ~ 5198387 (-)
LOC118938691 NA coding upstream 130969 5048143 ~ 5048790 (-)
G1208314 NA non-coding downstream 21210 4895499 ~ 4895724 (-)
G1208273 NA non-coding downstream 124125 4792571 ~ 4792809 (-)
G1208247 NA non-coding downstream 159544 4757174 ~ 4757390 (-)
G1208241 NA non-coding downstream 170558 4746170 ~ 4746376 (-)
G1208229 NA non-coding downstream 179075 4737637 ~ 4737859 (-)
G1208324 NA non-coding upstream 3316 4920490 ~ 4920693 (-)
G1208516 NA non-coding upstream 399760 5316934 ~ 5317603 (-)
G1208595 NA non-coding upstream 531198 5448372 ~ 5509385 (-)
G1208584 NA non-coding upstream 571456 5488630 ~ 5496282 (-)
G1206939 LOC100136477 other downstream 690965 4225039 ~ 4225969 (-)
LOC110488575 LOC106604935 other downstream 1182988 3728495 ~ 3733973 (-)
G1206357 LOC106604937 other downstream 1304641 3610803 ~ 3612293 (-)
G1206291 fbxo38 other downstream 1449265 3467063 ~ 3467669 (-)
G1206283 LOC106604946 other downstream 1465805 3449081 ~ 3451129 (-)
LOC110489463 LOC106601388 other upstream 624005 5541035 ~ 5542569 (-)
G1208831 NA other upstream 949148 5866322 ~ 5866950 (-)
G1209268 NA other upstream 1222186 6139360 ~ 6140037 (-)
G1209275 LOC106604892 other upstream 1228772 6145946 ~ 6150661 (-)

Expression


G1208321 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1208321 Expression in each Bioproject

Bar chart with 19 bars.
G1208321 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network