XLOC_031195


Basic Information

Item Value
gene id XLOC_031195
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 32782667 ~ 32784800 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00062038
CTTGTGAACTTAAAGGCAAAGTAATCAACTTAACATAAATCGCAAGATGCAATTTCACAGGGTCGGACGCCACCATACGTTCTAGATTGTCCTAGACATTTTTGACAACAGTAGGCTACCATGGCGGGTCTGATATTGCTGCTGAGGTAAAAGTAAGGCGTAAAAGAATAACCCACGAGGCAAGTGCATTGATCTGTAACATATTCTTCTTAATCGAAGTCTGGTAGATTTAATTTACCGGTATGACGCGTTGATGCTCTGTACGTTACGAGCACGAACTGTGTTGAGAGGGAGG

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0008152 metabolic process biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0043009 chordate embryonic development biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0019538 protein metabolic process biological_process
GO:0043603 cellular amide metabolic process biological_process
GO:0043604 amide biosynthetic process biological_process
GO:1901566 organonitrogen compound biosynthetic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0043043 peptide biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0007275 multicellular organism development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0006412 translation biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0009653 anatomical structure morphogenesis biological_process
GO:0048856 anatomical structure development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0044238 primary metabolic process biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0042255 ribosome assembly biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044267 cellular protein metabolic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0071704 organic substance metabolic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0006518 peptide metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032502 developmental process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0009792 embryo development ending in birth or egg hatching biological_process
GO:0044391 ribosomal subunit cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0022625 cytosolic large ribosomal subunit cellular_component
GO:0022626 cytosolic ribosome cellular_component
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0044445 obsolete cytosolic part cellular_component
GO:0005829 cytosol cellular_component
GO:0005840 ribosome cellular_component
GO:0015934 large ribosomal subunit cellular_component
GO:0015935 small ribosomal subunit cellular_component
GO:0043226 organelle cellular_component
GO:0043228 non-membrane-bounded organelle cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0043232 intracellular non-membrane-bounded organelle cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0005198 structural molecule activity molecular_function
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko05016 Huntington disease
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00062038 True 295 lncRNA 0.43 2 32782667 32784800

Neighbor

gene id symbol gene type direction distance location
XLOC_031194 NA coding downstream 45509 32560580 ~ 32737158 (-)
XLOC_031193 NA coding downstream 245918 32516671 ~ 32536749 (-)
XLOC_031192 ntmt1 coding downstream 277387 32499070 ~ 32505280 (-)
XLOC_031191 gpr107 coding downstream 292871 32460453 ~ 32489796 (-)
XLOC_031190 ncs1a coding downstream 336832 32402026 ~ 32445835 (-)
XLOC_031196 ptpa coding upstream 9086 32793886 ~ 32814417 (-)
XLOC_031197 lrsam1 coding upstream 80564 32865364 ~ 32882162 (-)
XLOC_031198 NA coding upstream 100379 32885179 ~ 32885874 (-)
XLOC_031199 pole3 coding upstream 103319 32888119 ~ 32890807 (-)
XLOC_031200 NA coding upstream 137856 32922656 ~ 32927919 (-)
XLOC_031187 NA non-coding downstream 425665 32342243 ~ 32357002 (-)
XLOC_031181 BX004981.3 non-coding downstream 612381 32170170 ~ 32170286 (-)
XLOC_031179 NA non-coding downstream 646246 32135202 ~ 32136421 (-)
XLOC_031209 CU019641.3 non-coding upstream 500726 33285526 ~ 33285597 (-)
XLOC_031210 NA non-coding upstream 501787 33286587 ~ 33286658 (-)
XLOC_031218 BX296533.1 non-coding upstream 1453107 34237907 ~ 34238023 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
striped catfish (Pangasianodon hypophthalmus) G42173 NA non-coding NC_047597.1 CM018543.1 7313668 ~ 7315596 (-)
tiger barb (Puntius tetrazona) G33857 NA non-coding NC_056703.1 CM032072.1 7166608 ~ 7168142 (+)