G1212387



Basic Information


Item Value
gene id G1212387
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 9178887 ~ 9179086 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1384549
ctcatatctccttccctagctttaagcatcagctgtcagagcagctcacagatcactgcacctgtacatagtccatctgtaaatagcccatccaactacctcatccctcatcttgctcctttgcaccccagtatctctacttgcacattcatcttctgcacatcaatcacttcagtgtttaattggtatattgtaattac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1384549 True 200 lncRNA 0.43 1 9178887 9179086
Loading

Neighbor


gene id symbol gene type direction distance location
xkrx LOC106604757 coding downstream 222345 8944381 ~ 8956542 (-)
nox1 LOC106604810 coding downstream 235970 8935291 ~ 8942917 (-)
bcorl1 LOC106604760 coding downstream 278001 8859834 ~ 8900886 (-)
LOC110487723 NA coding downstream 361962 8808895 ~ 8816925 (-)
LOC110488726 LOC106604766 coding downstream 399700 8771135 ~ 8779187 (-)
LOC110488737 LOC106604752 coding upstream 42531 9221617 ~ 9233562 (-)
taf7 taf7 coding upstream 54880 9233966 ~ 9246223 (-)
LOC110488741 LOC106604750 coding upstream 118215 9297301 ~ 9335885 (-)
LOC110489464 LOC106604611 coding upstream 159036 9338122 ~ 9340060 (-)
LOC110488746 LOC106604746 coding upstream 264376 9441509 ~ 9475071 (-)
G1212384 NA non-coding downstream 2318 9176335 ~ 9176569 (-)
G1212371 NA non-coding downstream 42670 9135967 ~ 9136217 (-)
G1212354 NA non-coding downstream 50340 9128322 ~ 9128547 (-)
G1212339 NA non-coding downstream 84802 9093512 ~ 9094085 (-)
G1212300 NA non-coding downstream 93485 9023616 ~ 9085402 (-)
G1212389 NA non-coding upstream 3099 9182185 ~ 9182388 (-)
G1212391 NA non-coding upstream 3849 9182935 ~ 9183297 (-)
G1212443 NA non-coding upstream 93453 9272539 ~ 9272739 (-)
G1212485 NA non-coding upstream 201250 9380336 ~ 9380603 (-)
G1212487 NA non-coding upstream 205229 9384315 ~ 9384613 (-)
G1212205 NA other downstream 341719 8836788 ~ 8837168 (-)
G1212202 NA other downstream 346063 8832451 ~ 8832824 (-)
LOC110488715 grhpr other downstream 600501 8570491 ~ 8578404 (-)
G1212070 NA other downstream 645252 8530729 ~ 8533635 (-)
G1212367 NA other upstream 37902 9216988 ~ 9218565 (-)
G1212483 NA other upstream 200108 9379194 ~ 9379527 (-)
G1212484 NA other upstream 200464 9379550 ~ 9380130 (-)
LOC110488750 LOC106604745 other upstream 329430 9504194 ~ 9510958 (-)

Expression


G1212387 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1212387 Expression in each Bioproject

Bar chart with 12 bars.
G1212387 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network