G1212483



Basic Information


Item Value
gene id G1212483
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 9379194 ~ 9379527 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1384648
gggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgaaactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaagggaaaaaaatttcagtctctcgatgtgc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1384648 True 334 TUCP 0.42 1 9379194 9379527
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110489464 LOC106604611 coding downstream 39134 9338122 ~ 9340060 (-)
LOC110488741 LOC106604750 coding downstream 43309 9297301 ~ 9335885 (-)
taf7 taf7 coding downstream 132971 9233966 ~ 9246223 (-)
LOC110488737 LOC106604752 coding downstream 145632 9221617 ~ 9233562 (-)
xkrx LOC106604757 coding downstream 422652 8944381 ~ 8956542 (-)
LOC110488746 LOC106604746 coding upstream 63935 9441509 ~ 9475071 (-)
LOC110488748 hnrpg coding upstream 98956 9478483 ~ 9484212 (-)
LOC110488750 LOC106604745 coding upstream 124667 9504194 ~ 9510958 (-)
LOC110488752 LOC106604742 coding upstream 239634 9619161 ~ 9624151 (-)
LOC110488755 NA coding upstream 296727 9675878 ~ 9710252 (-)
G1212443 NA non-coding downstream 106455 9272539 ~ 9272739 (-)
G1212391 NA non-coding downstream 195897 9182935 ~ 9183297 (-)
G1212389 NA non-coding downstream 196806 9182185 ~ 9182388 (-)
G1212387 NA non-coding downstream 200108 9178887 ~ 9179086 (-)
G1212384 NA non-coding downstream 202625 9176335 ~ 9176569 (-)
G1212485 NA non-coding upstream 809 9380336 ~ 9380603 (-)
G1212487 NA non-coding upstream 4788 9384315 ~ 9384613 (-)
G1212498 NA non-coding upstream 21046 9400573 ~ 9400862 (-)
G1212508 NA non-coding upstream 28244 9407771 ~ 9414167 (-)
G1212562 LOC106604808 non-coding upstream 51360 9430887 ~ 9433298 (-)
G1212367 NA other downstream 160629 9216988 ~ 9218565 (-)
bcorl1 LOC106604760 other downstream 513035 8859834 ~ 8900886 (-)
G1212205 NA other downstream 542026 8836788 ~ 8837168 (-)
G1212202 NA other downstream 546370 8832451 ~ 8832824 (-)
LOC110488715 grhpr other downstream 800808 8570491 ~ 8578404 (-)
G1212484 NA other upstream 23 9379550 ~ 9380130 (-)
LOC110488761 NA other upstream 815550 10192267 ~ 10270937 (-)
LOC110488774 LOC106604718 other upstream 1466419 10844755 ~ 10849852 (-)

Expression


G1212483 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1212483 Expression in each Bioproject

Bar chart with 15 bars.
G1212483 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network