G1212487



Basic Information


Item Value
gene id G1212487
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 9384315 ~ 9384613 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1384653
ataaagcaaagcagttcgacacatacaacgacacagagttacacatggagtaaaacaaacatacagtcaataatacagtataaacaagtctatatacgatgtgagcaaattaggtgagataagggaggttaaggcaaaaaaaggccatggtggcaaagtaaatacaatatagcaagtaaaacactgaaatggtagatttgcaatggaagaatgtgcaaagtagaaataaaaataatggggtgcaaaggagcaaaataaataactaaattaaatatagtagggaaagaggtagttgtttg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1384653 True 299 lncRNA 0.33 1 9384315 9384613
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110489464 LOC106604611 coding downstream 44255 9338122 ~ 9340060 (-)
LOC110488741 LOC106604750 coding downstream 48430 9297301 ~ 9335885 (-)
taf7 taf7 coding downstream 138092 9233966 ~ 9246223 (-)
LOC110488737 LOC106604752 coding downstream 150753 9221617 ~ 9233562 (-)
xkrx LOC106604757 coding downstream 427773 8944381 ~ 8956542 (-)
LOC110488746 LOC106604746 coding upstream 58849 9441509 ~ 9475071 (-)
LOC110488748 hnrpg coding upstream 93870 9478483 ~ 9484212 (-)
LOC110488750 LOC106604745 coding upstream 119581 9504194 ~ 9510958 (-)
LOC110488752 LOC106604742 coding upstream 234548 9619161 ~ 9624151 (-)
LOC110488755 NA coding upstream 291641 9675878 ~ 9710252 (-)
G1212485 NA non-coding downstream 3712 9380336 ~ 9380603 (-)
G1212443 NA non-coding downstream 111576 9272539 ~ 9272739 (-)
G1212391 NA non-coding downstream 201018 9182935 ~ 9183297 (-)
G1212389 NA non-coding downstream 201927 9182185 ~ 9182388 (-)
G1212387 NA non-coding downstream 205229 9178887 ~ 9179086 (-)
G1212498 NA non-coding upstream 15960 9400573 ~ 9400862 (-)
G1212508 NA non-coding upstream 23158 9407771 ~ 9414167 (-)
G1212562 LOC106604808 non-coding upstream 46274 9430887 ~ 9433298 (-)
G1212560 NA non-coding upstream 55966 9440579 ~ 9441098 (-)
G1212484 NA other downstream 4185 9379550 ~ 9380130 (-)
G1212483 NA other downstream 4788 9379194 ~ 9379527 (-)
G1212367 NA other downstream 165750 9216988 ~ 9218565 (-)
bcorl1 LOC106604760 other downstream 518156 8859834 ~ 8900886 (-)
G1212205 NA other downstream 547147 8836788 ~ 8837168 (-)
LOC110488761 NA other upstream 810464 10192267 ~ 10270937 (-)
LOC110488774 LOC106604718 other upstream 1461333 10844755 ~ 10849852 (-)
LOC110488799 LOC102314576 other upstream 1976898 11361504 ~ 11364211 (-)

Expression


G1212487 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1212487 Expression in each Bioproject

Bar chart with 13 bars.
G1212487 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network