G1212754



Basic Information


Item Value
gene id G1212754
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 9538647 ~ 9538978 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1384951
GGAAATAAGCGGCAGGCAGAAATACGCCATCCTGAGAGTTGTGAACATTTAAAGTGATACCGGATATACCATCTCGATCATCCGTTGGTGACACGGGCACATTATACTTTTATATAATCATCTGATCCACTACCATCCTATCCCTTGCAGATCCGCAGTCGACTTTTCATTTCCTGGTACGATGTGCGCATTTATACGTTGAGGCGTAAGCTATTATGCAATATGAGCTGCTGCATTGTCAGATACTGTTTTAACGTACAGTTTTTTTATCCAGAGGATATAGGCTAGTGAGCAGCTGGGTGGCTTTAAATTAATAGTTTACTGAGAAACGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1384951 True 332 lncRNA 0.42 1 9538647 9538978

Neighbor


gene id symbol gene type direction distance location
LOC110488750 LOC106604745 coding downstream 27689 9504194 ~ 9510958 (-)
LOC110488748 hnrpg coding downstream 54435 9478483 ~ 9484212 (-)
LOC110488746 LOC106604746 coding downstream 63576 9441509 ~ 9475071 (-)
LOC110489464 LOC106604611 coding downstream 198587 9338122 ~ 9340060 (-)
LOC110488741 LOC106604750 coding downstream 202762 9297301 ~ 9335885 (-)
LOC110488752 LOC106604742 coding upstream 80183 9619161 ~ 9624151 (-)
LOC110488755 NA coding upstream 137276 9675878 ~ 9710252 (-)
LOC110488756 fgf13 coding upstream 264405 9803383 ~ 10006358 (-)
LOC110488758 LOC106604741 coding upstream 515017 10053995 ~ 10080427 (-)
LOC110488757 LOC106604740 coding upstream 543824 10082802 ~ 10156644 (-)
G1212560 NA non-coding downstream 97549 9440579 ~ 9441098 (-)
G1212562 LOC106604808 non-coding downstream 105349 9430887 ~ 9433298 (-)
G1212508 NA non-coding downstream 124480 9407771 ~ 9414167 (-)
G1212864 NA non-coding upstream 178485 9717463 ~ 9717693 (-)
G1212868 NA non-coding upstream 180797 9719775 ~ 9720085 (-)
G1212876 NA non-coding upstream 185671 9724649 ~ 9724889 (-)
G1213540 NA non-coding upstream 295896 9834874 ~ 9858742 (-)
G1212484 NA other downstream 158517 9379550 ~ 9380130 (-)
G1212483 NA other downstream 159120 9379194 ~ 9379527 (-)
G1212367 NA other downstream 320082 9216988 ~ 9218565 (-)
LOC110488761 NA other upstream 656099 10192267 ~ 10270937 (-)
LOC110488774 LOC106604718 other upstream 1306968 10844755 ~ 10849852 (-)
LOC110488799 LOC102314576 other upstream 1822533 11361504 ~ 11364211 (-)
LOC110488801 rab33b other upstream 1853030 11390055 ~ 11393328 (-)
G1214997 NA other upstream 2035829 11574807 ~ 11575707 (-)

Expression


G1212754 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

G1212754 Expression in each Bioproject

Bar chart with 6 bars.
G1212754 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network