G1225174



Basic Information


Item Value
gene id G1225174
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 20012015 ~ 20012477 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1398416
gccagggccgccagtcagcatggagcagccagggccgccagtcagcatggagcagccagagccgccagtcagcatggagcagccagagccgccagtcagcatggagcagccagagccgccagtcagcatggagcagccagagccgccagtcagcatggagcagccagagccgccagtcagcatggagcagccagagccgccagtcagcatggagcagccagagcagccagtcagcatggagcagccagtgcagccagtcagcatggagcagccagtcagcatggagcagccagagcagccagtcagcatggagcagccagagcagccagtcagcatggagcagccagtcagcatggagcagccagagcagccagtcagcatggagcagccagaactgccagtcagccagactcttccagatctgccagtcagccagactcttccagatccaccagtcagccag

Function


NR:

description
PREDICTED: TBC1 domain family member 30-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1398416 True 463 TUCP 0.64 1 20012015 20012477
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110488959 LOC106604552 coding upstream 71001 19898094 ~ 19941014 (+)
LOC110488955 pigg coding upstream 363140 19529318 ~ 19648875 (+)
LOC110488954 LOC106604547 coding upstream 538665 19446119 ~ 19473350 (+)
trnav-uac-20 NA coding upstream 684436 19327504 ~ 19327579 (+)
phox2bb phox2b coding upstream 729380 19279607 ~ 19282635 (+)
LOC110488963 clic2 coding downstream 173594 20186071 ~ 20191531 (+)
LOC110488964 LOC106604434 coding downstream 187851 20200328 ~ 20202340 (+)
LOC110488965 LOC106604435 coding downstream 203723 20216200 ~ 20253685 (+)
tmem255a LOC106604438 coding downstream 262505 20274982 ~ 20295212 (+)
LOC110488973 nkap coding downstream 296160 20308619 ~ 20314136 (+)
G1225172 NA non-coding upstream 1423 20010365 ~ 20010592 (+)
G1225168 NA non-coding upstream 8493 20003281 ~ 20003522 (+)
G1225159 NA non-coding upstream 21698 19990112 ~ 19990317 (+)
G1225155 NA non-coding upstream 23618 19988179 ~ 19988397 (+)
G1224835 NA non-coding upstream 44499 19967031 ~ 19967516 (+)
G1225175 NA non-coding downstream 603 20013080 ~ 20013288 (+)
G1225197 NA non-coding downstream 32751 20045228 ~ 20045458 (+)
G1225201 NA non-coding downstream 39335 20051812 ~ 20052093 (+)
G1225179 NA non-coding downstream 42050 20054527 ~ 20076910 (+)
G1225220 NA non-coding downstream 86157 20098634 ~ 20098888 (+)
G1225173 NA other upstream 482 20011030 ~ 20011533 (+)
LOC110488935 LOC106604530 other upstream 1816007 18104635 ~ 18196487 (+)
G1222640 NA other upstream 1970366 18041345 ~ 18041649 (+)
G1219625 NA other upstream 4395039 15615929 ~ 15616976 (+)
G1225840 NA other downstream 683195 20695672 ~ 20696137 (+)
G1228466 LOC100136012 other downstream 2840838 22853315 ~ 22853661 (+)
shisa3 shisa3 other downstream 3604246 23616713 ~ 23622863 (+)
LOC110489020 LOC106609103 other downstream 4435823 24448300 ~ 24458335 (+)

Expression


G1225174 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1225174 Expression in each Bioproject

Bar chart with 18 bars.
G1225174 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network