G1226108



Basic Information


Item Value
gene id G1226108
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 20998010 ~ 20998759 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1399442
GGATAGGTTTGTATTCCTAATGAGGAATCAGGATAGGTTTGTATTCCTAATGAGGAATCAGGATAGGTTTCTAGTCCTAATGTGGAATCAGTCTATGTTTCTAGTCCTAATGAGGACCTCTCCTATTAATTCCTGAATAGAAACTCTGGAGCAGGTCCTTTAAAGACCTATCAAGTGATAGCCATAGATCTATAGGTCCAGTAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1399442 True 204 lncRNA 0.39 2 20998010 20998759
Loading

Neighbor


gene id symbol gene type direction distance location
pcdh19 LOC106604451 coding upstream 84789 20823043 ~ 20913221 (+)
elf1 LOC106604448 coding upstream 527474 20390733 ~ 20470536 (+)
trnae-uuc-6 NA coding upstream 607845 20390094 ~ 20390165 (+)
LOC110488977 LOC106604447 coding upstream 617289 20375493 ~ 20380721 (+)
LOC110488975 LOC106604445 coding upstream 623154 20332797 ~ 20374856 (+)
glra4a LOC106604454 coding downstream 1112301 22111060 ~ 22190415 (+)
gla gla coding downstream 1220900 22219659 ~ 22227024 (+)
btk btk coding downstream 1235175 22233934 ~ 22254573 (+)
timm8a timm8a coding downstream 1256260 22255019 ~ 22256391 (+)
mars2 mars2 coding downstream 1264329 22263088 ~ 22273849 (+)
G1225982 NA non-coding upstream 193196 20804504 ~ 20804814 (+)
G1225862 NA non-coding upstream 284017 20713760 ~ 20713993 (+)
G1225849 NA non-coding upstream 296886 20700804 ~ 20701124 (+)
G1225831 NA non-coding upstream 308320 20689465 ~ 20689690 (+)
G1225774 NA non-coding upstream 353100 20644693 ~ 20644910 (+)
G1226173 NA non-coding downstream 97941 21096700 ~ 21101944 (+)
G1226151 NA non-coding downstream 190285 21189044 ~ 21203201 (+)
G1226241 LOC106613263 non-coding downstream 219112 21217871 ~ 21218407 (+)
G1226268 NA non-coding downstream 277256 21276015 ~ 21276356 (+)
G1226337 LOC106604453 non-coding downstream 392262 21391021 ~ 21439603 (+)
G1225840 NA other upstream 301873 20695672 ~ 20696137 (+)
LOC110488973 nkap other upstream 683900 20308619 ~ 20314136 (+)
G1225174 NA other upstream 985533 20012015 ~ 20012477 (+)
G1225173 NA other upstream 986477 20011030 ~ 20011533 (+)
phox2bb phox2b other upstream 1717076 19279607 ~ 19282635 (+)
G1228466 LOC100136012 other downstream 1854556 22853315 ~ 22853661 (+)
shisa3 shisa3 other downstream 2617964 23616713 ~ 23622863 (+)
LOC110489020 LOC106609103 other downstream 3449541 24448300 ~ 24458335 (+)
G1231863 NA other downstream 4947953 25946712 ~ 25952747 (+)
G1231862 LOC106604502 other downstream 4963698 25962457 ~ 25966312 (+)

Expression


G1226108 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1226108 Expression in each Bioproject

Bar chart with 1 bar.
G1226108 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network