G1228143



Basic Information


Item Value
gene id G1228143
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 22724746 ~ 22793060 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1401612
aaatgtcaggaattgtgagaaactggagtttaaatgtatttggctaaggtgtatgtaaacttccgacttcaacgtcaccaaacccactggctccaggtcatccacaagtctttgctaggtaaagccccgccttatcaaatcaaataaaatttatttatatagcccttcgtacatcagctgatatctcaaagtgctgtacagaaacccag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1401612 True 209 lncRNA 0.40 2 22724746 22793060

Neighbor


gene id symbol gene type direction distance location
LOC110488995 NA coding upstream 373864 22345297 ~ 22350882 (+)
mars2 mars2 coding upstream 450897 22263088 ~ 22273849 (+)
timm8a timm8a coding upstream 468355 22255019 ~ 22256391 (+)
btk btk coding upstream 470173 22233934 ~ 22254573 (+)
gla gla coding upstream 497722 22219659 ~ 22227024 (+)
LOC110487749 LOC106604462 coding downstream 108698 22901758 ~ 23256369 (+)
ky ky coding downstream 521888 23314948 ~ 23321657 (+)
LOC118938707 NA coding downstream 779913 23572973 ~ 23573977 (+)
shisa3 shisa3 coding downstream 823653 23616713 ~ 23622863 (+)
grxcr1a grxcr1 coding downstream 1032314 23825374 ~ 23830234 (+)
G1227969 NA non-coding upstream 247788 22474804 ~ 22476958 (+)
G1227911 LOC106604462 non-coding upstream 287294 22434148 ~ 22437452 (+)
G1227926 NA non-coding upstream 321551 22402858 ~ 22403195 (+)
G1227740 NA non-coding upstream 387229 22337117 ~ 22337517 (+)
G1227703 NA non-coding upstream 448193 22275486 ~ 22276553 (+)
G1228195 NA non-coding downstream 15567 22808627 ~ 22808837 (+)
G1228198 NA non-coding downstream 20999 22814059 ~ 22814328 (+)
G1228465 NA non-coding downstream 59715 22852775 ~ 22853074 (+)
G1228475 NA non-coding downstream 66624 22859684 ~ 22859977 (+)
G1228485 NA non-coding downstream 74088 22867148 ~ 22867357 (+)
G1225840 NA other upstream 2028609 20695672 ~ 20696137 (+)
LOC110488973 nkap other upstream 2410636 20308619 ~ 20314136 (+)
G1225174 NA other upstream 2712269 20012015 ~ 20012477 (+)
G1225173 NA other upstream 2713213 20011030 ~ 20011533 (+)
phox2bb phox2b other upstream 3443812 19279607 ~ 19282635 (+)
G1228466 LOC100136012 other downstream 60255 22853315 ~ 22853661 (+)
LOC110489020 LOC106609103 other downstream 1655240 24448300 ~ 24458335 (+)
G1231863 NA other downstream 3153652 25946712 ~ 25952747 (+)
G1231862 LOC106604502 other downstream 3169397 25962457 ~ 25966312 (+)

Expression


G1228143 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G1228143 Expression in each Bioproject

Bar chart with 11 bars.
G1228143 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network