G1228589



Basic Information


Item Value
gene id G1228589
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 22990361 ~ 22990561 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1402104
CAATGCCATAGCTGATGCCGCCGGATAATTTTAGGCCTGCTCTAGTCCCCAGAGCAGACAGTTAGCAGCATCAGTCCCCCCAGTGACGGCTACTTCAATACTTTACTAAAGCAGAACTATTCTATACTGGACTAGAGCAAAAAACGGATATACTGAACTAGAGCAGAACGCTTCTATACTGGACAAGAGCAGAAAGCCCAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1402104 True 201 lncRNA 0.47 1 22990361 22990561
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110488995 NA coding upstream 639479 22345297 ~ 22350882 (+)
mars2 mars2 coding upstream 716512 22263088 ~ 22273849 (+)
timm8a timm8a coding upstream 733970 22255019 ~ 22256391 (+)
btk btk coding upstream 735788 22233934 ~ 22254573 (+)
gla gla coding upstream 763337 22219659 ~ 22227024 (+)
ky ky coding downstream 324387 23314948 ~ 23321657 (+)
LOC118938707 NA coding downstream 582412 23572973 ~ 23573977 (+)
shisa3 shisa3 coding downstream 626152 23616713 ~ 23622863 (+)
grxcr1a grxcr1 coding downstream 834813 23825374 ~ 23830234 (+)
LOC110489012 znf518b coding downstream 878007 23868568 ~ 23873598 (+)
G1228587 NA non-coding upstream 1421 22987665 ~ 22988940 (+)
G1228586 NA non-coding upstream 3019 22986338 ~ 22987342 (+)
G1228584 NA non-coding upstream 5369 22984761 ~ 22984992 (+)
G1228580 NA non-coding upstream 11718 22978435 ~ 22978643 (+)
G1228485 NA non-coding upstream 123004 22867148 ~ 22867357 (+)
G1228590 NA non-coding downstream 1270 22991831 ~ 22992057 (+)
G1228593 NA non-coding downstream 4633 22995194 ~ 23025577 (+)
G1228602 NA non-coding downstream 20425 23010986 ~ 23015493 (+)
G1228646 NA non-coding downstream 104670 23095231 ~ 23095442 (+)
G1228649 NA non-coding downstream 108165 23098726 ~ 23098942 (+)
G1228466 LOC100136012 other upstream 136700 22853315 ~ 22853661 (+)
G1225840 NA other upstream 2294224 20695672 ~ 20696137 (+)
LOC110488973 nkap other upstream 2676251 20308619 ~ 20314136 (+)
G1225174 NA other upstream 2977884 20012015 ~ 20012477 (+)
G1225173 NA other upstream 2978828 20011030 ~ 20011533 (+)
LOC110489020 LOC106609103 other downstream 1457739 24448300 ~ 24458335 (+)
G1231863 NA other downstream 2956151 25946712 ~ 25952747 (+)
G1231862 LOC106604502 other downstream 2971896 25962457 ~ 25966312 (+)
G1232217 NA other downstream 3164995 26155556 ~ 26156812 (+)

Expression


G1228589 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1228589 Expression in each Bioproject

Bar chart with 7 bars.
G1228589 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network