G1228761



Basic Information


Item Value
gene id G1228761
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 23338327 ~ 23342741 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1402297
ttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgacactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatatttttgtatccaaatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaccggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatga

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1402297 True 756 lncRNA 0.42 2 23338327 23342741

Neighbor


gene id symbol gene type direction distance location
ky ky coding upstream 16670 23314948 ~ 23321657 (+)
LOC110487749 LOC106604462 coding upstream 81958 22901758 ~ 23256369 (+)
LOC110488995 NA coding upstream 987445 22345297 ~ 22350882 (+)
mars2 mars2 coding upstream 1064478 22263088 ~ 22273849 (+)
timm8a timm8a coding upstream 1081936 22255019 ~ 22256391 (+)
LOC118938707 NA coding downstream 230232 23572973 ~ 23573977 (+)
shisa3 shisa3 coding downstream 273972 23616713 ~ 23622863 (+)
grxcr1a grxcr1 coding downstream 482633 23825374 ~ 23830234 (+)
LOC110489012 znf518b coding downstream 525827 23868568 ~ 23873598 (+)
LOC110489017 fa55c coding downstream 1057742 24400483 ~ 24439204 (+)
G1228698 NA non-coding upstream 122709 23209743 ~ 23215618 (+)
G1228661 NA non-coding upstream 215238 23122882 ~ 23123089 (+)
G1228650 NA non-coding upstream 237160 23100913 ~ 23101167 (+)
G1228649 NA non-coding upstream 239385 23098726 ~ 23098942 (+)
G1228646 NA non-coding upstream 242885 23095231 ~ 23095442 (+)
G1228832 NA non-coding downstream 137313 23480054 ~ 23480287 (+)
G1228842 NA non-coding downstream 150635 23493376 ~ 23493689 (+)
G1228843 NA non-coding downstream 151816 23494557 ~ 23494784 (+)
G1228845 NA non-coding downstream 153334 23496075 ~ 23496340 (+)
G1228848 NA non-coding downstream 155330 23498071 ~ 23498794 (+)
G1228466 LOC100136012 other upstream 484666 22853315 ~ 22853661 (+)
G1225840 NA other upstream 2642190 20695672 ~ 20696137 (+)
LOC110488973 nkap other upstream 3024217 20308619 ~ 20314136 (+)
G1225174 NA other upstream 3325850 20012015 ~ 20012477 (+)
G1225173 NA other upstream 3326794 20011030 ~ 20011533 (+)
LOC110489020 LOC106609103 other downstream 1105559 24448300 ~ 24458335 (+)
G1231863 NA other downstream 2603971 25946712 ~ 25952747 (+)
G1231862 LOC106604502 other downstream 2619716 25962457 ~ 25966312 (+)
G1232217 NA other downstream 2812815 26155556 ~ 26156812 (+)

Expression


G1228761 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1228761 Expression in each Bioproject

Bar chart with 21 bars.
G1228761 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network