G1228832



Basic Information


Item Value
gene id G1228832
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 23480054 ~ 23480287 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1402376
GTTGTATAACATACAGAACATACAATTAAGGAGAGGTCAAATCAACATATGGAGTGGGTCCAGAAGGCTAGAAGCACACTATAGAGACCATTGTTGGAACATGGGCTATAAATAAGGGTTGAGAGTAACAAATATAGTTAGATCACTAACTGTGGTGTGTTATCGTTATACAATAGAAGTGTCTCAAACACTTTTCTCAATGCAAAGCTATAATGCATTATAATAGTCATACTG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1402376 True 234 lncRNA 0.35 1 23480054 23480287

Neighbor


gene id symbol gene type direction distance location
ky ky coding upstream 158397 23314948 ~ 23321657 (+)
LOC110487749 LOC106604462 coding upstream 223685 22901758 ~ 23256369 (+)
LOC110488995 NA coding upstream 1129172 22345297 ~ 22350882 (+)
mars2 mars2 coding upstream 1206205 22263088 ~ 22273849 (+)
timm8a timm8a coding upstream 1223663 22255019 ~ 22256391 (+)
LOC118938707 NA coding downstream 92686 23572973 ~ 23573977 (+)
shisa3 shisa3 coding downstream 136426 23616713 ~ 23622863 (+)
grxcr1a grxcr1 coding downstream 345087 23825374 ~ 23830234 (+)
LOC110489012 znf518b coding downstream 388281 23868568 ~ 23873598 (+)
LOC110489017 fa55c coding downstream 920196 24400483 ~ 24439204 (+)
G1228745 NA non-coding upstream 114522 23292486 ~ 23365532 (+)
G1228761 NA non-coding upstream 137313 23338327 ~ 23342741 (+)
G1228698 NA non-coding upstream 264436 23209743 ~ 23215618 (+)
G1228661 NA non-coding upstream 356965 23122882 ~ 23123089 (+)
G1228650 NA non-coding upstream 378887 23100913 ~ 23101167 (+)
G1228842 NA non-coding downstream 13089 23493376 ~ 23493689 (+)
G1228843 NA non-coding downstream 14270 23494557 ~ 23494784 (+)
G1228845 NA non-coding downstream 15788 23496075 ~ 23496340 (+)
G1228848 NA non-coding downstream 17784 23498071 ~ 23498794 (+)
G1228847 NA non-coding downstream 19469 23499756 ~ 23500323 (+)
G1228466 LOC100136012 other upstream 626393 22853315 ~ 22853661 (+)
G1225840 NA other upstream 2783917 20695672 ~ 20696137 (+)
LOC110488973 nkap other upstream 3165944 20308619 ~ 20314136 (+)
G1225174 NA other upstream 3467577 20012015 ~ 20012477 (+)
G1225173 NA other upstream 3468521 20011030 ~ 20011533 (+)
LOC110489020 LOC106609103 other downstream 968013 24448300 ~ 24458335 (+)
G1231863 NA other downstream 2466425 25946712 ~ 25952747 (+)
G1231862 LOC106604502 other downstream 2482170 25962457 ~ 25966312 (+)
G1232217 NA other downstream 2675269 26155556 ~ 26156812 (+)

Expression


G1228832 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1228832 Expression in each Bioproject

Bar chart with 1 bar.
G1228832 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network