G1228890



Basic Information


Item Value
gene id G1228890
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 23582244 ~ 23582592 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1402443
GGGCGGCTGTCTGTGGAGGATTAGAGTTTAACAGATGTTGTAAACATGAAACTGTGTAATTCCGAACTTTATCCGCAACGTTATATTCCATTTGGTTAAACTGAAGCAATACCTCTGCCATGTACTTAATTGTAACATGGACAGCTCATTGTATTGTTTGAGGAATTGATTATTAGTTAGATATGCAACTCATGCACCAAATGGCAGTTATCACAATCCCCACATCAGGAATGATTCAGAACTTCCTCCCTGTGATTTACTTGTTCCTGCTTTGTAAAATACAGAAGTTCAATAGAACCTTCAATGTTATCTATGCATTTCCATTGGCAAAAGACATACAAGTATTGGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1402443 True 349 lncRNA 0.38 1 23582244 23582592

Neighbor


gene id symbol gene type direction distance location
LOC118938707 NA coding upstream 8267 23572973 ~ 23573977 (+)
ky ky coding upstream 260587 23314948 ~ 23321657 (+)
LOC110487749 LOC106604462 coding upstream 325875 22901758 ~ 23256369 (+)
LOC110488995 NA coding upstream 1231362 22345297 ~ 22350882 (+)
mars2 mars2 coding upstream 1308395 22263088 ~ 22273849 (+)
shisa3 shisa3 coding downstream 34121 23616713 ~ 23622863 (+)
grxcr1a grxcr1 coding downstream 242782 23825374 ~ 23830234 (+)
LOC110489012 znf518b coding downstream 285976 23868568 ~ 23873598 (+)
LOC110489017 fa55c coding downstream 817891 24400483 ~ 24439204 (+)
LOC110489020 LOC106609103 coding downstream 868840 24448300 ~ 24458335 (+)
G1228860 NA non-coding upstream 48091 23533233 ~ 23534153 (+)
G1228836 NA non-coding upstream 63776 23515067 ~ 23518468 (+)
G1228847 NA non-coding upstream 81921 23499756 ~ 23500323 (+)
G1228848 NA non-coding upstream 83450 23498071 ~ 23498794 (+)
G1228845 NA non-coding upstream 85904 23496075 ~ 23496340 (+)
G1228893 NA non-coding downstream 9719 23592311 ~ 23592535 (+)
G1228895 NA non-coding downstream 11047 23593639 ~ 23593899 (+)
G1228897 NA non-coding downstream 13325 23595917 ~ 23598010 (+)
G1228899 NA non-coding downstream 25683 23608275 ~ 23608677 (+)
G1228900 bend4 non-coding downstream 26165 23608757 ~ 23609342 (+)
G1228466 LOC100136012 other upstream 728583 22853315 ~ 22853661 (+)
G1225840 NA other upstream 2886107 20695672 ~ 20696137 (+)
LOC110488973 nkap other upstream 3268134 20308619 ~ 20314136 (+)
G1225174 NA other upstream 3569767 20012015 ~ 20012477 (+)
G1225173 NA other upstream 3570711 20011030 ~ 20011533 (+)
G1231863 NA other downstream 2364120 25946712 ~ 25952747 (+)
G1231862 LOC106604502 other downstream 2379865 25962457 ~ 25966312 (+)
G1232217 NA other downstream 2572964 26155556 ~ 26156812 (+)

Expression


G1228890 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G1228890 Expression in each Bioproject

Bar chart with 9 bars.
G1228890 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network