G1229788



Basic Information


Item Value
gene id G1229788
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 24013845 ~ 24014082 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1403452
ccagactgaagcatttcgtatacattgtttgtcttcaggaaggcagtgagttgctgcgcaacagccttttctcaaatttttgagaggaatggaagattcgatataagccgatagttttttatattttctgggtcaaggtttggctttttcaagagaggctttattactgccacttttagtgagtttggtacacatccggtggatagagagccgtttattatgttcaacataggagggg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1403452 True 238 lncRNA 0.41 1 24013845 24014082
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110489012 znf518b coding upstream 140247 23868568 ~ 23873598 (+)
grxcr1a grxcr1 coding upstream 183611 23825374 ~ 23830234 (+)
shisa3 shisa3 coding upstream 390982 23616713 ~ 23622863 (+)
LOC118938707 NA coding upstream 439868 23572973 ~ 23573977 (+)
ky ky coding upstream 692188 23314948 ~ 23321657 (+)
LOC110489017 fa55c coding downstream 386401 24400483 ~ 24439204 (+)
LOC110489020 LOC106609103 coding downstream 437350 24448300 ~ 24458335 (+)
csn6 cops6 coding downstream 452605 24466687 ~ 24474857 (+)
gpc2 gpc2 coding downstream 525084 24539166 ~ 24551802 (+)
LOC110489028 LOC106604497 coding downstream 587990 24602072 ~ 24608023 (+)
G1229061 NA non-coding upstream 174740 23836490 ~ 23839105 (+)
G1228903 bend4 non-coding upstream 400398 23612872 ~ 23613447 (+)
G1228900 bend4 non-coding upstream 404503 23608757 ~ 23609342 (+)
G1228899 NA non-coding upstream 405168 23608275 ~ 23608677 (+)
G1229823 NA non-coding downstream 17528 24031610 ~ 24031882 (+)
G1229883 NA non-coding downstream 60508 24074590 ~ 24075012 (+)
G1229884 NA non-coding downstream 61382 24075464 ~ 24076005 (+)
G1229894 NA non-coding downstream 77943 24092025 ~ 24092345 (+)
G1229952 NA non-coding downstream 129103 24143185 ~ 24143425 (+)
G1228466 LOC100136012 other upstream 1160184 22853315 ~ 22853661 (+)
G1225840 NA other upstream 3317708 20695672 ~ 20696137 (+)
LOC110488973 nkap other upstream 3699735 20308619 ~ 20314136 (+)
G1225174 NA other upstream 4001368 20012015 ~ 20012477 (+)
G1231863 NA other downstream 1932630 25946712 ~ 25952747 (+)
G1231862 LOC106604502 other downstream 1948375 25962457 ~ 25966312 (+)
G1232217 NA other downstream 2141474 26155556 ~ 26156812 (+)
ube2d2 UBE2D2 other downstream 2686148 26699956 ~ 26711938 (+)

Expression


G1229788 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1229788 Expression in each Bioproject

Bar chart with 16 bars.
G1229788 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network