G1232285



Basic Information


Item Value
gene id G1232285
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 26166850 ~ 26168701 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1406201
AGGTTATTAACATAGTGTTGACAATACTAAGGTTATTAACATAGTGTGACCAATACTAAGGTTATTAACATACTGTTACCAATACCAAGGTTATTACCGTAGTGTTACAATACCAAGGTTATTAACATAGTGTTACAATACCAAGGTTATTTACGTAGTGTTGCCAATACCAAGGTTATTACCGTAGTATTACAATACCAAGGTTATTAACGTAGTGTTACTAATACT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1406201 True 228 lncRNA 0.32 2 26166850 26168701

Neighbor


gene id symbol gene type direction distance location
LOC110487757 LOC106604428 coding upstream 1319533 24845319 ~ 24847317 (+)
LOC110489030 LOC106604504 coding upstream 1361027 24796037 ~ 24805823 (+)
LOC118938753 LOC106604427 coding upstream 1370984 24794268 ~ 24795866 (+)
LOC118938752 LOC106604500 coding upstream 1387043 24777786 ~ 24779807 (+)
LOC110489478 LOC106604427 coding upstream 1392645 24772274 ~ 24774205 (+)
LOC110487765 LOC106604415 coding downstream 424796 26593497 ~ 26596531 (+)
LOC110489093 LOC106604406 coding downstream 430252 26598953 ~ 26631213 (+)
ube2d2 UBE2D2 coding downstream 531255 26699956 ~ 26711938 (+)
zgc:110843 LOC106604402 coding downstream 546437 26715138 ~ 26725964 (+)
LOC110489089 LOC106604414 coding downstream 558040 26726741 ~ 26729567 (+)
G1232217 NA non-coding upstream 10038 26155556 ~ 26156812 (+)
G1232164 NA non-coding upstream 130813 26022274 ~ 26036037 (+)
G1232162 NA non-coding upstream 145348 26021065 ~ 26021502 (+)
G1231882 NA non-coding upstream 222807 25943483 ~ 25944043 (+)
G1231810 NA non-coding upstream 307072 25838753 ~ 25859778 (+)
G1232312 NA non-coding downstream 21035 26189736 ~ 26192281 (+)
G1232315 NA non-coding downstream 24131 26192832 ~ 26193077 (+)
G1232318 NA non-coding downstream 25877 26194578 ~ 26194879 (+)
G1232322 NA non-coding downstream 27793 26196494 ~ 26196725 (+)
G1232486 NA non-coding downstream 138553 26307254 ~ 26307461 (+)
G1231862 LOC106604502 other upstream 200538 25962457 ~ 25966312 (+)
G1231863 NA other upstream 214103 25946712 ~ 25952747 (+)
LOC110489020 LOC106609103 other upstream 1708515 24448300 ~ 24458335 (+)
shisa3 shisa3 other upstream 2545602 23616713 ~ 23622863 (+)
LOC110489086 LOC106604400 other downstream 590486 26759123 ~ 26801405 (+)
G1233046 NA other downstream 660990 26829691 ~ 26830102 (+)

Expression


G1232285 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1232285 Expression in each Bioproject

Bar chart with 2 bars.
G1232285 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network