G1238155



Basic Information


Item Value
gene id G1238155
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 32143005 ~ 32147870 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1413022
acttaaacagagcttctttaataaccaaacataggtaggctcagatggaccggcagattccgacaggacaggacaaggttacagcaaacatgacgatagtctggttcaggcatgaaacacaacaaacaagaatccgacaaggacaggaacaaaaacagagagagatatagaggactaatcagagggaaaaagggaacaggtgggaaaaggggtgacgaggt
>TU1413023
acttaaacagagcttctttaataaccaaacataggtaggctcagatggaccggcagattccgacaggacaggacaaggttacagcaaacatgacgatagtctggttcaggcatgaaacacaacaaacaagaatccgacaaggacaggaacaaaaacagagagagatatagaggactaatcagagggaaaaagggaacaggtgggaaaaggggtgacgaggt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1413022 False 221 lncRNA 0.45 2 32143005 32147870
TU1413023 True 221 lncRNA 0.45 2 32143005 32147870
Loading

Neighbor


gene id symbol gene type direction distance location
si:ch211-153b23.7 LOC106604275 coding downstream 273030 31859266 ~ 31869975 (-)
LOC110489137 LOC106612186 coding downstream 307055 31741516 ~ 31835950 (-)
LOC118938722 NA coding downstream 386202 31754266 ~ 31756803 (-)
LOC110489134 LOC106604270 coding downstream 419534 31720562 ~ 31723471 (-)
cuedc2 cuedc2 coding downstream 424089 31716123 ~ 31718916 (-)
LOC110489151 LOC106604257 coding upstream 423264 32571134 ~ 32573704 (-)
LOC110489150 LOC106604256 coding upstream 429306 32577176 ~ 32610818 (-)
LOC110489154 NA coding upstream 557552 32705422 ~ 32714985 (-)
LOC110489153 LOC106604217 coding upstream 584752 32732622 ~ 32739363 (-)
LOC110489155 LOC106604251 coding upstream 593632 32741502 ~ 32743616 (-)
G1238049 NA non-coding downstream 191715 31950910 ~ 31951290 (-)
G1238034 NA non-coding downstream 213344 31929343 ~ 31929661 (-)
G1238023 NA non-coding downstream 220891 31908755 ~ 31922114 (-)
G1237992 NA non-coding downstream 290677 31851956 ~ 31852328 (-)
G1237956 NA non-coding downstream 403083 31739261 ~ 31739922 (-)
G1238202 NA non-coding upstream 117344 32265214 ~ 32266763 (-)
G1238217 NA non-coding upstream 135739 32283609 ~ 32284054 (-)
G1238223 NA non-coding upstream 150453 32298323 ~ 32298522 (-)
G1238226 NA non-coding upstream 158714 32306584 ~ 32309937 (-)
G1238229 NA non-coding upstream 161338 32309208 ~ 32310074 (-)
G1237388 LOC106604302 other downstream 780323 31350043 ~ 31362682 (-)
LOC118938717 LOC105024420 other downstream 1193117 30912876 ~ 30992444 (-)
G1237075 LOC106612148 other downstream 1369259 30768947 ~ 30773746 (-)
G1236423 NA other downstream 1839812 30298624 ~ 30303193 (-)
LOC110487772 LOC106612141 other downstream 1871551 30143782 ~ 30271667 (-)
G1238232 LOC106604321 other upstream 169386 32317256 ~ 32318058 (-)
G1238233 LOC106604321 other upstream 172148 32320018 ~ 32324555 (-)
G1238344 NA other upstream 248891 32396761 ~ 32399179 (-)
G1238347 NA other upstream 252543 32400413 ~ 32400900 (-)
G1238363 LOC106612212 other upstream 280122 32427992 ~ 32429975 (-)

Expression


G1238155 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1238155 Expression in each Bioproject

Bar chart with 11 bars.
G1238155 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network