G1238457



Basic Information


Item Value
gene id G1238457
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 32564177 ~ 32564440 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1413421
cttagctgtcttcagctcagtaccagagtaacttagctgtcttcagctcagtaccagagtaacttagctgtcttcagctcagtaccagagtaacttagctgtcttcagctcagtaccagaggagcttagctgtcttcagctcagtaccagagtaacttagctgtcttcagctcagtaccagagtatcttagctgtcttcagctcagtaccagaggagcttagctgtcttcagctcagtaccagaggagcttagctgtcttcagc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1413421 True 264 lncRNA 0.48 1 32564177 32564440
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110489140 LOC106612212 coding upstream 134102 32427794 ~ 32430075 (+)
LOC110489141 LOC106604320 coding upstream 140098 32398296 ~ 32424079 (+)
zgc:66447 LOC106604327 coding upstream 166308 32379198 ~ 32397869 (+)
LOC110489144 NA coding upstream 193051 32359890 ~ 32371126 (+)
LOC110489145 LOC106604324 coding upstream 206693 32353690 ~ 32357484 (+)
LOC110489148 LOC106604253 coding downstream 101822 32666262 ~ 32701558 (+)
LOC110487782 LOC106604250 coding downstream 179168 32743608 ~ 32754406 (+)
LOC110489156 LOC106604248 coding downstream 201993 32766433 ~ 32774618 (+)
LOC110487783 LOC106612196 coding downstream 214025 32778465 ~ 32812861 (+)
LOC110489160 LOC106604244 coding downstream 251341 32815781 ~ 32827231 (+)
G1238456 NA non-coding upstream 4550 32559406 ~ 32559627 (+)
G1238436 NA non-coding upstream 16613 32547317 ~ 32547564 (+)
G1238420 NA non-coding upstream 38281 32525668 ~ 32525896 (+)
G1238407 NA non-coding upstream 54566 32509388 ~ 32509611 (+)
G1238404 NA non-coding upstream 57222 32505553 ~ 32506955 (+)
G1238467 LOC106604256 non-coding downstream 14787 32579227 ~ 32580407 (+)
G1238472 NA non-coding downstream 22539 32586979 ~ 32587219 (+)
G1238474 NA non-coding downstream 29277 32593717 ~ 32594027 (+)
G1238477 NA non-coding downstream 33517 32597957 ~ 32598339 (+)
G1238482 NA non-coding downstream 52136 32616576 ~ 32616780 (+)
pin4 pin4 other upstream 1269410 31288367 ~ 31294783 (+)
G1236704 LOC106612150 other upstream 1677026 30882949 ~ 30887151 (+)
G1236717 NA other upstream 1699690 30864051 ~ 30864487 (+)
G1235511 NA other upstream 2915134 29646994 ~ 29649043 (+)
G1239015 NA other downstream 1214038 33773304 ~ 33799267 (+)
G1241074 NA other downstream 2715911 35280351 ~ 35280667 (+)
G1241386 NA other downstream 3241961 35806401 ~ 35807149 (+)
G1241466 NA other downstream 3461658 36026098 ~ 36033170 (+)
G1242376 NA other downstream 4101563 36666003 ~ 36666719 (+)

Expression


G1238457 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1238457 Expression in each Bioproject

Bar chart with 10 bars.
G1238457 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network