G1240539 (LOC106604211)



Basic Information


Item Value
gene id G1240539
gene name LOC106604211
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 34653561 ~ 34653889 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1415864
GCAAAAATGCATTTTAAAACACTAAATAGGAATGGTTCTTTGGTATTTCTTTCTAAAAATGAAGTATATTGTTTCCATATATCCTATTATAACCAGGTAAAGGAGGTTTCTTTCTAACCTTTCTTGTAGATGGCGTCACAACCCTTCCCCATCTTGTCCTTGTTGTTGGCATCTCCCTCCATGTAAGGGAAGACTCGGGCCTGGTAGGTCCAGGCGTAGTCCTTAGAACCAAAGAACTGAACGGGGAACTCCCCCACCTCGTGTTTCATACGGAGGATGTTCTCTGGGACGTTCTTAGGAAGACACACCTCCGCAGGCCACCACCTGAA

Function


NR:

description
PREDICTED: histone-lysine N-methyltransferase, H3 lysine-36 and H4 lysine-20 specific-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1415864 True 329 lncRNA 0.45 1 34653561 34653889

Neighbor


gene id symbol gene type direction distance location
LOC110489177 pp2aa coding downstream 25891 34622630 ~ 34627670 (-)
LOC110487787 sfxn1 coding downstream 34630 34586666 ~ 34618931 (-)
LOC118938726 NA coding downstream 210604 34441064 ~ 34443131 (-)
LOC110489166 LOC106604233 coding downstream 355891 34294193 ~ 34297670 (-)
LOC110489172 LOC106604229 coding downstream 361316 34288581 ~ 34292245 (-)
ccdc69 LOC106604205 coding upstream 229502 34883391 ~ 34904800 (-)
LOC118938728 NA coding upstream 243787 34897676 ~ 34900540 (-)
gm2a sap3 coding upstream 260171 34914060 ~ 34921098 (-)
LOC118938729 NA coding upstream 371285 35025174 ~ 35028163 (-)
LOC110489216 LOC106604190 coding upstream 388202 35042091 ~ 35082780 (-)
G1240537 NA non-coding downstream 3095 34649796 ~ 34650466 (-)
G1240535 NA non-coding downstream 8370 34644900 ~ 34645191 (-)
G1240533 NA non-coding downstream 11524 34641492 ~ 34642037 (-)
G1240515 NA non-coding downstream 90017 34562996 ~ 34563544 (-)
G1240508 NA non-coding downstream 105473 34547859 ~ 34548088 (-)
G1240541 LOC106604211 non-coding upstream 560 34654449 ~ 34655184 (-)
G1240540 LOC106604211 non-coding upstream 1623 34655512 ~ 34655759 (-)
G1240544 NA non-coding upstream 3883 34657772 ~ 34702146 (-)
G1240545 NA non-coding upstream 25857 34679746 ~ 34681672 (-)
G1240550 NA non-coding upstream 34899 34688788 ~ 34689622 (-)
G1240534 NA other downstream 9409 34643135 ~ 34644152 (-)
G1240399 NA other downstream 310670 34337823 ~ 34342891 (-)
G1239090 ogt other downstream 1957159 32695876 ~ 32696402 (-)
G1240963 NA other upstream 408034 35061923 ~ 35062319 (-)
G1240953 NA other upstream 453939 35107828 ~ 35125496 (-)
G1241697 NA other upstream 863888 35517777 ~ 35519330 (-)
matr3l1.1 LOC106604139 other upstream 929422 35578460 ~ 35589383 (-)
G1242169 NA other upstream 1762089 36415978 ~ 36418075 (-)

Expression


G1240539(LOC106604211) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

G1240539(LOC106604211) Expression in each Bioproject

Bar chart with 7 bars.
G1240539(LOC106604211) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network