G1240963



Basic Information


Item Value
gene id G1240963
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 35061923 ~ 35062319 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1416350
GGACAAGATACCAGCAGTGTGGATGTTATCATCACTGGAGTGGACAAGATACCAGCAGTGTGGATGTTATCATCACTGGAGTGGACAAGATACCAGCAGTGTGGATGTTATCATCACTGGAGTGGACAAGATACCAGCAGTGTGGATGTTATCATCACTGTGTGGAGAGGACACGATACCAGCAGTTTGGATGTTATCATCACTGGAGTGGACAAGATACCAGCAGTTTAGATGTTATCATCACTGTGTGGAGAGGACACGATACCAGCAGTTTGGATGTTATCATCACTGGAGTGGACAAGATACCAGCAGTACCAGCAGTGTGGATGTTATCATCACTGTGTGGAGAGGACAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1416350 True 355 TUCP 0.46 2 35061923 35062319

Neighbor


gene id symbol gene type direction distance location
LOC118938729 NA coding downstream 33760 35025174 ~ 35028163 (-)
gm2a sap3 coding downstream 140825 34914060 ~ 34921098 (-)
ccdc69 LOC106604205 coding downstream 157123 34883391 ~ 34904800 (-)
LOC118938728 NA coding downstream 161383 34897676 ~ 34900540 (-)
LOC110489177 pp2aa coding downstream 434253 34622630 ~ 34627670 (-)
glra1 glra1 coding upstream 96296 35158615 ~ 35267880 (-)
thoc3 LOC106604138 coding upstream 472997 35535316 ~ 35538759 (-)
shtn3 LOC106612280 coding upstream 477367 35539686 ~ 35566407 (-)
si:rp71-1d10.5 tmm80 coding upstream 504490 35566809 ~ 35571846 (-)
matr3l1.1 LOC106604139 coding upstream 516141 35578460 ~ 35589383 (-)
G1240957 NA non-coding downstream 24711 35036565 ~ 35037212 (-)
G1240833 NA non-coding downstream 27104 35034488 ~ 35034819 (-)
G1240829 NA non-coding downstream 32302 35029324 ~ 35029621 (-)
G1240785 NA non-coding downstream 97130 34963913 ~ 34964793 (-)
G1240713 NA non-coding downstream 135546 34926107 ~ 34926377 (-)
G1240973 NA non-coding upstream 29637 35091956 ~ 35093064 (-)
G1240987 NA non-coding upstream 64697 35127016 ~ 35127300 (-)
G1240971 LOC106604193 non-coding upstream 74159 35136478 ~ 35143093 (-)
G1240997 NA non-coding upstream 90488 35152807 ~ 35153283 (-)
G1240998 NA non-coding upstream 91036 35153355 ~ 35154076 (-)
G1240534 NA other downstream 417771 34643135 ~ 34644152 (-)
G1240533 NA other downstream 419886 34641492 ~ 34642037 (-)
G1240399 NA other downstream 719032 34337823 ~ 34342891 (-)
LOC110489172 LOC106604229 other downstream 769753 34288581 ~ 34292245 (-)
G1239090 ogt other downstream 2365521 32695876 ~ 32696402 (-)
G1240953 NA other upstream 45509 35107828 ~ 35125496 (-)
G1241697 NA other upstream 455458 35517777 ~ 35519330 (-)
G1242169 NA other upstream 1353659 36415978 ~ 36418075 (-)
G1243234 NA other upstream 2383450 37445769 ~ 37446210 (-)

Expression


G1240963 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G1240963 Expression in each Bioproject

Bar chart with 16 bars.
G1240963 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network