G1243234



Basic Information


Item Value
gene id G1243234
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 37445769 ~ 37446210 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1419009
GAAGTAGGTTTCATGTGTCGGGCCTTACCTCTCCAACACTACACTGCAGTAGACTACATGTGTTGGGCCTTACCTATCAAACACTACACTGCAGTAGGCTACATGTGTTGGGCCTTACCTATCAAACACTACACTGCAGTAGGCTACATGTGTCGGGCCTTATCTATCAAACACTACACTGCAGTAGACTACATGTGTCGGGCCTTACCTATCAAACACTACACTGCAGTAGACTACATGTGTTGGGCCTTACCTATCAAACACTACACTGCAGTAGACTACATGTGTTGGGCCTTACCTATCAAACACTACACTGCAGTAGACTACATGTGTTGGGCCTTACCTATCAAACACTACACTGCAGTAGGCTACATGTGTCGGGCCTTACCTATCAAACACTACACTGCAGTAGACTACATGTGTTGGGCCTTACCTATCAAAC

Function


NR:

description
PREDICTED: ral GTPase-activating protein subunit beta-like isoform X10

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1419009 True 442 TUCP 0.46 1 37445769 37446210
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110510782 mid2 coding downstream 1066507 36145477 ~ 36379262 (-)
LOC110489193 peam3 coding downstream 1371667 36043082 ~ 36074102 (-)
LOC110489191 LOC106604152 coding downstream 1468002 35943307 ~ 35977767 (-)
LOC100305133 LOC106604149 coding downstream 1508457 35895251 ~ 35937312 (-)
gpr137 g137a coding downstream 1565533 35868806 ~ 35880236 (-)
LOC110489226 LOC106604165 coding upstream 195644 37641854 ~ 37688173 (-)
LOC110489227 NA coding upstream 254610 37700820 ~ 37745238 (-)
LOC110489228 ef-1g coding upstream 337092 37783302 ~ 37802457 (-)
LOC118938777 NA coding upstream 353862 37800072 ~ 37800148 (-)
rpb7 rpb7 coding upstream 357378 37803588 ~ 37810500 (-)
G1243230 NA non-coding downstream 3147 37442152 ~ 37442622 (-)
G1243228 NA non-coding downstream 3829 37437922 ~ 37441940 (-)
G1243229 NA non-coding downstream 10649 37434139 ~ 37435120 (-)
G1243149 NA non-coding downstream 126688 37315899 ~ 37319081 (-)
G1243117 NA non-coding downstream 190822 37252967 ~ 37254947 (-)
G1243261 NA non-coding upstream 30858 37477068 ~ 37477315 (-)
G1243264 LOC106581475 non-coding upstream 31201 37477411 ~ 37477702 (-)
G1243273 NA non-coding upstream 38813 37485023 ~ 37485235 (-)
G1243276 NA non-coding upstream 40901 37487111 ~ 37487372 (-)
G1243287 NA non-coding upstream 47346 37493556 ~ 37497371 (-)
G1242169 NA other downstream 1027694 36415978 ~ 36418075 (-)
matr3l1.1 LOC106604139 other downstream 1856776 35578460 ~ 35589383 (-)
G1241697 NA other downstream 1926439 35517777 ~ 35519330 (-)
G1240953 NA other downstream 2320273 35107828 ~ 35125496 (-)
G1240963 NA other downstream 2383450 35061923 ~ 35062319 (-)
G1243718 NA other upstream 326421 37772631 ~ 37773270 (-)
G1244197 NA other upstream 1054477 38500687 ~ 38500999 (-)
G1244755 LOC106604128 other upstream 1403436 38824503 ~ 38852543 (-)
G1244972 rnf44 other upstream 1839444 39285654 ~ 39298246 (-)
G1245005 NA other upstream 1976649 39422859 ~ 39424565 (-)

Expression


G1243234 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1243234 Expression in each Bioproject

Bar chart with 3 bars.
G1243234 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network