G1246531



Basic Information


Item Value
gene id G1246531
gene name NA
gene type misc
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 41377034 ~ 41379594 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1423134
GTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATAGTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACCGGGTATGGTAACTATACTGGTTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATAGTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATAGTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGG
>TU1423138
ATACGGGAGAGTCCCGATGCAGCCTGCGGTACAGGGAGATTCCATCGCTTTAGACCCAAGCAGGATGTGAGGTCACAACTTGGAATGGGAATGTTACTTCACATAGGAACCTCAGACCaggccaatatcagatatgtcaatgtcctgggaaatgttcttgttacttacaacctcatgctaatcacattagcctacattatcTCAACTGTCCCGCGGgagacccaccaatcctgaagaggATCGTCAGAGTCATAGCACCCATGACATTTCAAATATCAATGAATGACCAGGACCTGAGGTAACAGTAATAGCTGTGGGAAGCAGGTATGGGACCTATACTAGGTATGGTAACTATACTGGGTATGGTAACTATACCGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATAGTAGGTATGGTAACTATACTAGGTATGGTAACTATACTGGGTATGGTAACTATAGCAGGTATGGTAACTATACTGGTTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATAGTAGGTATGGTAACTATACTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATAGTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGG
>TU1423140
CTATACTGGTAACTATACTAGGTATGGTAACTATACTGGTAACTATACTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGGTTATGGTAACTATACTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATAGTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1423134 False 337 lncRNA 0.38 2 41377034 41377790
TU1423138 False 774 TUCP 0.42 3 41377034 41379594
TU1423140 True 213 lncRNA 0.36 2 41377034 41378367
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110487959 ergic1 coding downstream 18159 41317663 ~ 41358875 (-)
LOC118938767 NA coding downstream 324719 41050692 ~ 41052315 (-)
LOC118938734 LOC106604122 coding downstream 391332 40976712 ~ 40985775 (-)
LOC110489236 prelid1 coding downstream 406585 40950986 ~ 40970449 (-)
LOC110489235 fam193b coding downstream 450300 40861900 ~ 40926734 (-)
LOC110487966 isk1 coding upstream 170920 41549287 ~ 41551540 (-)
LOC110487963 LOC106604100 coding upstream 250031 41628398 ~ 41655871 (-)
LOC110524910 LOC106604098 coding upstream 301732 41680099 ~ 41709893 (-)
LOC118938737 NA coding upstream 448268 41826635 ~ 41827086 (-)
LOC118938768 fgf16 coding upstream 540015 41918382 ~ 41927885 (-)
G1246529 NA non-coding downstream 373 41372866 ~ 41376661 (-)
G1246515 NA non-coding downstream 36867 41339733 ~ 41340167 (-)
G1246510 NA non-coding downstream 37344 41315140 ~ 41339690 (-)
G1246514 NA non-coding downstream 47534 41329093 ~ 41329500 (-)
G1246470 NA non-coding downstream 63803 41312357 ~ 41313231 (-)
G1246540 NA non-coding upstream 19411 41397778 ~ 41398126 (-)
G1246542 NA non-coding upstream 21428 41399795 ~ 41400130 (-)
G1246546 NA non-coding upstream 23472 41401839 ~ 41402135 (-)
G1246558 NA non-coding upstream 33024 41411391 ~ 41411632 (-)
G1246566 NA non-coding upstream 36719 41415086 ~ 41415540 (-)
G1246175 NA other downstream 442467 40933172 ~ 40934567 (-)
G1246044 NA other downstream 629456 40745525 ~ 40747578 (-)
G1246021 NA other downstream 707463 40668575 ~ 40669571 (-)
G1246806 NA other upstream 234760 41613127 ~ 41613833 (-)
G1247036 NA other upstream 732346 42110713 ~ 42111119 (-)
G1247239 NA other upstream 916160 42294527 ~ 42297572 (-)
G1247271 LOC106604092 other upstream 994448 42372815 ~ 42409235 (-)
G1247328 NA other upstream 1111059 42437711 ~ 42493195 (-)

Expression


G1246531 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1246531 Expression in each Bioproject

Bar chart with 10 bars.
G1246531 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network