G1246598



Basic Information


Item Value
gene id G1246598
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 41537862 ~ 41538794 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1423216
ataccagttctttgtgatgtgaggtagtttataccagttctttgtgatgagaggtgaggtagtttataccagttctttgtgatgagaggtagtttataccagttctttgtgatgtgagcaagtttataccagttctttgtgatgagaggtgaggtagtttataccagttctttgtgatgagaggtgaggtagtttataccagttctttgtgatgagaggtgaggtagtttataccagttctttgtgatgtgaggtagtttataccag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1423216 True 267 lncRNA 0.39 2 41537862 41538794

Neighbor


gene id symbol gene type direction distance location
neurl1b neurl1b coding upstream 33255 41478639 ~ 41504607 (+)
LOC110487960 LOC106604105 coding upstream 161856 41369616 ~ 41376006 (+)
LOC110487799 LOC106591130 coding upstream 224578 41058075 ~ 41313284 (+)
LOC110489244 LOC106594455 coding upstream 783798 40751881 ~ 40757026 (+)
LOC110487794 LOC104930052 coding upstream 2091800 39374971 ~ 39446062 (+)
LOC118938735 LOC106604103 coding downstream 46273 41585067 ~ 41590216 (+)
LOC110487965 LOC106604102 coding downstream 60487 41599281 ~ 41602756 (+)
LOC110487964 LOC106604101 coding downstream 74262 41613056 ~ 41626307 (+)
LOC110487800 LOC106604099 coding downstream 186536 41725330 ~ 41830078 (+)
LOC110533244 LOC106604078 coding downstream 553093 42091887 ~ 42105699 (+)
G1246569 NA non-coding upstream 84768 41452889 ~ 41453094 (+)
G1246568 NA non-coding upstream 85793 41451814 ~ 41452069 (+)
G1246563 NA non-coding upstream 122718 41414895 ~ 41415144 (+)
G1246556 NA non-coding upstream 129388 41408198 ~ 41408474 (+)
G1246599 NA non-coding downstream 214 41539008 ~ 41540232 (+)
G1246600 NA non-coding downstream 2618 41541412 ~ 41541760 (+)
G1246635 NA non-coding downstream 89860 41628654 ~ 41629276 (+)
G1246644 LOC106604100 non-coding downstream 109260 41648054 ~ 41648770 (+)
G1246647 NA non-coding downstream 112611 41651405 ~ 41652546 (+)
G1246102 NA other upstream 649353 40878741 ~ 40888509 (+)
G1246103 NA other upstream 651311 40880016 ~ 40886551 (+)
G1246017 NA other upstream 876298 40661222 ~ 40661564 (+)
LOC110489238 LOC106604092 other downstream 829668 42368435 ~ 42377369 (+)
LOC110519852 LOC106604089 other downstream 905781 42444535 ~ 42493206 (+)
LOC110514351 hdx other downstream 1354241 42873811 ~ 42922578 (+)
hmgn6 NA other downstream 1515776 43054499 ~ 43062453 (+)

Expression


G1246598 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1246598 Expression in each Bioproject

Bar chart with 19 bars.
G1246598 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network