LOC118938784



Basic Information


Item Value
gene id LOC118938784
gene name NA
gene type misc
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 10436449 ~ 10437044 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005036039.1
ATACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTACTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTACTGTTGAATACAGGTGAGTAGTAGTGTTGAATACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTACTGTTGAATACAGGTGAGTAGTAGTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTGCTGTTG
>TU1436009
CAAATAAGCAATAATTATGCAGTTTGAGCATACAGGTGAGTAGTACTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTAGTACTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTGAACAGGTGAGTAGTGCTGTTGAATACAGGTGAGTAGTGCTGTTGCAGGTAAGGACACACACTAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005036039.1 False 429 mRNA 0.44 3 10436493 10437015
TU1436009 True 223 lncRNA 0.43 4 10436449 10437044

Neighbor


gene id symbol gene type direction distance location
LOC110490904 LOC106590606 coding downstream 67760 10337017 ~ 10368733 (-)
LOC110489570 LOC106590600 coding downstream 140451 10256343 ~ 10296042 (-)
LOC110489568 LOC106590608 coding downstream 189933 10220497 ~ 10246560 (-)
LOC110489563 cbln2b coding downstream 1014470 9418351 ~ 9422023 (-)
LOC110514162 LOC106590620 coding downstream 1472280 8963472 ~ 8964213 (-)
trnac-gca-10 NA coding upstream 1380 10438395 ~ 10438466 (-)
LOC110489574 hgd coding upstream 8551 10445566 ~ 10459083 (-)
LOC110490822 NA coding upstream 157534 10594549 ~ 10600184 (-)
LOC110489577 LOC106590594 coding upstream 197045 10634060 ~ 10648867 (-)
LOC118938785 NA coding upstream 210858 10647873 ~ 10648163 (-)
G1257042 NA non-coding downstream 48359 10387784 ~ 10388134 (-)
G1257041 NA non-coding downstream 49518 10386655 ~ 10386975 (-)
G1256969 NA non-coding downstream 59284 10376931 ~ 10377209 (-)
G1256952 NA non-coding downstream 102407 10333715 ~ 10334086 (-)
G1256951 NA non-coding downstream 102889 10333321 ~ 10333604 (-)
G1257090 NA non-coding upstream 51846 10488861 ~ 10521170 (-)
G1257073 NA non-coding upstream 55921 10492936 ~ 10503880 (-)
G1257256 NA non-coding upstream 169998 10607013 ~ 10607770 (-)
G1257263 LOC106590595 non-coding upstream 181679 10618694 ~ 10622859 (-)
G1257267 NA non-coding upstream 203087 10640102 ~ 10695847 (-)
G1256654 NA other downstream 561751 9873519 ~ 9874742 (-)
G1256146 NA other downstream 957675 9477813 ~ 9478818 (-)
G1255735 NA other downstream 1412490 9023584 ~ 9024003 (-)
G1254214 NA other downstream 3110037 7325712 ~ 7326456 (-)
G1257642 NA other upstream 381428 10818443 ~ 10818911 (-)
LOC110489593 LOC106590549 other upstream 2073857 12507315 ~ 12533443 (-)
LOC110489604 mllt10 other upstream 2905038 13288725 ~ 13369504 (-)
G1260199 NA other upstream 2949374 13386389 ~ 13387587 (-)
G1260226 LOC106590529 other upstream 3025850 13462865 ~ 13505161 (-)

Expression


LOC118938784 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

LOC118938784 Expression in each Bioproject

Bar chart with 8 bars.
LOC118938784 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network