trnaa-ugc-66



Basic Information


Item Value
gene id trnaa-ugc-66
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 27093489 ~ 27093563 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnaa-ugc-66
ggtcccgtgtggctcagctggtagagcatggtgcttgcaacaccagggttgtgggttcgattcccacggggacca

Function


NR:

description
Deoxyribonuclease gamma precursor

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnaa-ugc-66 True 75 mRNA 0.61 1 27093489 27093563
Loading

Neighbor


gene id symbol gene type direction distance location
kif9 kif9 coding upstream 119440 26960749 ~ 26974049 (+)
LOC110489897 LOC100380682 coding upstream 164707 26923894 ~ 26928782 (+)
LOC110489896 LOC106590184 coding upstream 174841 26860119 ~ 26918648 (+)
topbp1 LOC106590185 coding upstream 244457 26811022 ~ 26849032 (+)
LOC110489893 LOC106590186 coding upstream 282910 26761940 ~ 26810579 (+)
LOC110489907 LOC106590173 coding downstream 238923 27332486 ~ 27350841 (+)
chpf2 LOC106590171 coding downstream 268240 27361803 ~ 27369326 (+)
asap1b LOC106590164 coding downstream 358717 27452280 ~ 27519315 (+)
fam49bb LOC106590167 coding downstream 430562 27524125 ~ 27563497 (+)
LOC110489920 LOC106590161 coding downstream 678054 27771617 ~ 27795387 (+)
G1275563 LOC106590178 non-coding upstream 3397 27079719 ~ 27090092 (+)
G1275272 NA non-coding upstream 111032 26975679 ~ 26982457 (+)
G1275257 NA non-coding upstream 158212 26935037 ~ 26935277 (+)
G1275251 NA non-coding upstream 170042 26923152 ~ 26923447 (+)
G1275243 NA non-coding upstream 182066 26911196 ~ 26911423 (+)
G1275573 NA non-coding downstream 9274 27102837 ~ 27103117 (+)
G1275576 NA non-coding downstream 11720 27105283 ~ 27105492 (+)
G1275637 NA non-coding downstream 96271 27189834 ~ 27195235 (+)
G1275642 NA non-coding downstream 110424 27203987 ~ 27263740 (+)
G1275629 NA non-coding downstream 113253 27206816 ~ 27231469 (+)
G1274830 NA other upstream 651102 26440011 ~ 26442387 (+)
G1274765 NA other upstream 728343 26364278 ~ 26365146 (+)
rbis cssa29h8orf59 other upstream 2118776 24968304 ~ 24976522 (+)
G1272672 LOC106590208 other upstream 2130448 24959932 ~ 25027501 (+)
G1275572 NA other downstream 7746 27101309 ~ 27102027 (+)
G1276288 NA other downstream 760055 27853618 ~ 27854013 (+)
G1276733 NA other downstream 1096623 28190186 ~ 28256406 (+)
G1277159 NA other downstream 1480753 28574316 ~ 28624218 (+)
G1277279 NA other downstream 1721803 28815366 ~ 28815810 (+)

Expression


trnaa-ugc-66 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

trnaa-ugc-66 Expression in each Bioproject

Bar chart with 7 bars.
trnaa-ugc-66 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network