trnap-ugg-11


Basic Information

Item Value
gene id trnap-ugg-11
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 41236986 ~ 41237057 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>trnap-ugg-11
ggctcgttggtctcggggtatgattctcgctttgggtgtgagaggtcccgggttcaaatcccggacgagccc

Function

NR:

description
PREDICTED: serine/threonine-protein kinase Nek3-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
trnap-ugg-11 True 72 mRNA 0.60 1 41236986 41237057
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110490065 LOC106580667 coding upstream 80129 41093530 ~ 41156857 (+)
tfdp2 LOC105026801 coding upstream 148448 41030376 ~ 41088538 (+)
LOC110490048 il-1racp coding upstream 1104386 40089464 ~ 40132600 (+)
LOC110490053 fgf12 coding upstream 1183910 39936886 ~ 40053076 (+)
LOC110490050 LOC106612350 coding upstream 1307761 39845713 ~ 39929225 (+)
trnap-ugg-12 NA coding downstream 1799 41238856 ~ 41238927 (+)
trnap-ugg-13 NA coding downstream 2734 41239791 ~ 41239862 (+)
trnap-ugg-14 NA coding downstream 3669 41240726 ~ 41240797 (+)
trnap-ugg-15 NA coding downstream 5539 41242596 ~ 41242667 (+)
trnap-ugg-16 NA coding downstream 6474 41243531 ~ 41243602 (+)
G1292932 NA non-coding upstream 1967 41234547 ~ 41235019 (+)
G1292922 NA non-coding upstream 11214 41225537 ~ 41225772 (+)
G1292792 NA non-coding upstream 39209 41197095 ~ 41197777 (+)
G1292775 LOC106612405 non-coding upstream 59923 41176206 ~ 41177063 (+)
G1292774 NA non-coding upstream 61266 41175464 ~ 41175720 (+)
G1292939 NA non-coding downstream 21824 41258881 ~ 41385174 (+)
G1292941 NA non-coding downstream 25311 41262368 ~ 41263796 (+)
G1292944 NA non-coding downstream 51847 41288904 ~ 41384912 (+)
trnap-cgg-68 NA non-coding downstream 123750 41360807 ~ 41381768 (+)
trnap-cgg-114 NA non-coding downstream 169916 41406973 ~ 41407518 (+)
G1291464 NA other upstream 1169079 40067558 ~ 40067907 (+)
G1290614 NA other upstream 2109977 39126272 ~ 39127009 (+)
G1290549 LOC106590036 other upstream 2199327 39037005 ~ 39061248 (+)
G1289710 NA other upstream 2636745 38594880 ~ 38600241 (+)
G1293072 NA other downstream 346316 41583216 ~ 41589030 (+)
G1293295 NA other downstream 671977 41909034 ~ 41909611 (+)
G1294319 NA other downstream 1527796 42764853 ~ 42767937 (+)
G1295348 LOC106602853 other downstream 2359867 43596924 ~ 43597464 (+)
G1295730 NA other downstream 2679121 43916178 ~ 43916479 (+)

Expression

trnap-ugg-11 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network