trnap-ugg-12



Basic Information


Item Value
gene id trnap-ugg-12
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 41238856 ~ 41238927 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnap-ugg-12
ggcttgttggtctaggggtatgattctcgctttgggtgcgagaggtcccgggttcaaatcccggacgagccc

Function


NR:

description
PREDICTED: serine/threonine-protein kinase Nek3-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnap-ugg-12 True 72 mRNA 0.61 1 41238856 41238927
Loading

Neighbor


gene id symbol gene type direction distance location
trnap-ugg-11 NA coding upstream 1799 41236986 ~ 41237057 (+)
LOC110490065 LOC106580667 coding upstream 81999 41093530 ~ 41156857 (+)
tfdp2 LOC105026801 coding upstream 150318 41030376 ~ 41088538 (+)
LOC110490048 il-1racp coding upstream 1106256 40089464 ~ 40132600 (+)
LOC110490053 fgf12 coding upstream 1185780 39936886 ~ 40053076 (+)
trnap-ugg-13 NA coding downstream 864 41239791 ~ 41239862 (+)
trnap-ugg-14 NA coding downstream 1799 41240726 ~ 41240797 (+)
trnap-ugg-15 NA coding downstream 3669 41242596 ~ 41242667 (+)
trnap-ugg-16 NA coding downstream 4604 41243531 ~ 41243602 (+)
trnap-ugg-17 NA coding downstream 5539 41244466 ~ 41244537 (+)
G1292932 NA non-coding upstream 3837 41234547 ~ 41235019 (+)
G1292922 NA non-coding upstream 13084 41225537 ~ 41225772 (+)
G1292792 NA non-coding upstream 41079 41197095 ~ 41197777 (+)
G1292775 LOC106612405 non-coding upstream 61793 41176206 ~ 41177063 (+)
G1292774 NA non-coding upstream 63136 41175464 ~ 41175720 (+)
G1292939 NA non-coding downstream 19954 41258881 ~ 41385174 (+)
G1292941 NA non-coding downstream 23441 41262368 ~ 41263796 (+)
G1292944 NA non-coding downstream 49977 41288904 ~ 41384912 (+)
trnap-cgg-68 NA non-coding downstream 121880 41360807 ~ 41381768 (+)
trnap-cgg-114 NA non-coding downstream 168046 41406973 ~ 41407518 (+)
G1291464 NA other upstream 1170949 40067558 ~ 40067907 (+)
G1290614 NA other upstream 2111847 39126272 ~ 39127009 (+)
G1290549 LOC106590036 other upstream 2201197 39037005 ~ 39061248 (+)
G1289710 NA other upstream 2638615 38594880 ~ 38600241 (+)
G1293072 NA other downstream 344446 41583216 ~ 41589030 (+)
G1293295 NA other downstream 670107 41909034 ~ 41909611 (+)
G1294319 NA other downstream 1525926 42764853 ~ 42767937 (+)
G1295348 LOC106602853 other downstream 2357997 43596924 ~ 43597464 (+)
G1295730 NA other downstream 2677251 43916178 ~ 43916479 (+)

Expression


trnap-ugg-12 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network