trnaa-ugc-68



Basic Information


Item Value
gene id trnaa-ugc-68
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 42322046 ~ 42322117 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnaa-ugc-68
ggggatgtagctcagtgatagagcgcatgctttgcttgtatgaggtcctgggttcaatccccagcttctcta

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnaa-ugc-68 True 72 mRNA 0.51 1 42322046 42322117

Neighbor


gene id symbol gene type direction distance location
LOC110490086 LOC106612440 coding upstream 67033 42154291 ~ 42255013 (+)
LOC110490085 LOC106612498 coding upstream 267436 42039954 ~ 42054610 (+)
LOC118938919 NA coding upstream 298720 42019476 ~ 42023326 (+)
LOC110490081 LOC106580643 coding upstream 370214 41925174 ~ 41951832 (+)
iqcg iqcg coding upstream 485916 41810243 ~ 41836130 (+)
trnat-ugu-37 NA coding downstream 1427 42323544 ~ 42323615 (+)
trnaa-ugc-69 NA coding downstream 2349 42324466 ~ 42324537 (+)
trnaa-ugc-70 NA coding downstream 3271 42325388 ~ 42325459 (+)
trnaa-ugc-71 NA coding downstream 4194 42326311 ~ 42326382 (+)
trnaa-ugc-72 NA coding downstream 5117 42327234 ~ 42327305 (+)
G1293974 NA non-coding upstream 17493 42304297 ~ 42304553 (+)
G1293798 NA non-coding upstream 64881 42256868 ~ 42257165 (+)
G1293769 NA non-coding upstream 120143 42201430 ~ 42201903 (+)
G1293637 NA non-coding upstream 252097 42069660 ~ 42069949 (+)
G1293603 NA non-coding upstream 271238 42009531 ~ 42050808 (+)
trnaa-ugc-118 NA non-coding downstream 49688 42371805 ~ 42383605 (+)
G1294052 NA non-coding downstream 127358 42449475 ~ 42449737 (+)
G1294276 NA non-coding downstream 235273 42557390 ~ 42568776 (+)
G1294336 NA non-coding downstream 322897 42645014 ~ 42645230 (+)
G1294325 NA non-coding downstream 361507 42683624 ~ 42684414 (+)
G1293295 NA other upstream 412435 41909034 ~ 41909611 (+)
G1293072 NA other upstream 733902 41583216 ~ 41589030 (+)
LOC110490048 il-1racp other upstream 2191312 40089464 ~ 40132600 (+)
G1291464 NA other upstream 2254139 40067558 ~ 40067907 (+)
G1290614 NA other upstream 3195037 39126272 ~ 39127009 (+)
G1294319 NA other downstream 442736 42764853 ~ 42767937 (+)
G1295348 LOC106602853 other downstream 1274807 43596924 ~ 43597464 (+)
G1295730 NA other downstream 1594061 43916178 ~ 43916479 (+)
G1295845 NA other downstream 1707319 44029436 ~ 44029861 (+)
cblb cblb other downstream 1999386 44173352 ~ 44326246 (+)

Expression


trnaa-ugc-68 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network