trnaa-ugc-118



Basic Information


Item Value
gene id trnaa-ugc-118
gene name NA
gene type misc
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 42371805 ~ 42383605 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnaa-ugc-118
ggggatgtagctcagtggtagagtgcatgctttgcatgtatgaggtcctgggttcaatccccagcttctcca
>TU1476613
tgtctctttttggtccatttagattgttaatgtagattgtatagaattatttatttttatgttatggttaaacattttaatgttttactgtgacttgtcgtaggctcctaagtggaccataaggttaaaaaccaaaccaaattaagaaaactaaactgaaaaacaaaaaaatacaattaaaaactaagttgctccgccagagtgtctcttttgggtcacttttgctggTCCCTAGCCCGgatttgtttgttccatgtgtaactctgtgttgttgtttgtgttgcactgctttgctttatcttggccaggtcgcagtggtgtatgagaacttgtccttaactggcttacctggttaaataaaggtgacatttaaaaaaataagcaacATATTTTTCTTttgcagaaaggggatgtagctcagtggtagagtgcatgctttgcatgtatgaggtcctgggttcaatccccagcttctccatgtttCTTTGCAAAGACCCAgcttctactttccagaatgttgaaattctaagcaggaaacagagatgtgcaaaatcatttggtcttgtaatctgaagaatatgcgttcaatccctgttagtacatttatagaacagaagtggcatggttgccaacttttatggcatcattttcaaaaactgaagttcatgttttcgatccctgtccgtacctgtttcaagaattgctgctatcatttcattgtagtttcaatggagtggtgtatataaaagtacattgtattaatagttcacccctccgcttccagactgtatatgaatgtgggaagccgccgctggctgatcccgccctggcttacatttaaaaaaaaaaacacgattaacctgaattaggccagactagttaccatcattttctcacattgcaattgaacatttttctattgtctctttttggtccatttagattgttaatgtagattgtatagaattatttatttttatgttatggaaaaacatt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnaa-ugc-118 False 72 mRNA 0.53 1 42372211 42372282
TU1476613 True 996 lncRNA 0.36 2 42371805 42383605

Neighbor


gene id symbol gene type direction distance location
trnaa-ugc-117 NA coding upstream 850 42371290 ~ 42371361 (+)
trnaa-ugc-116 NA coding upstream 1772 42370368 ~ 42370439 (+)
trnaa-ugc-115 NA coding upstream 2690 42369450 ~ 42369521 (+)
trnaa-ugc-114 NA coding upstream 3611 42368529 ~ 42368600 (+)
trnaa-ugc-113 NA coding upstream 4534 42367606 ~ 42367677 (+)
trnaa-ugc-119 NA coding downstream 849 42373131 ~ 42373202 (+)
trnaa-ugc-120 NA coding downstream 1771 42374053 ~ 42374124 (+)
LOC110490089 zpld1 coding downstream 25811 42398093 ~ 42444039 (+)
LOC110490091 crcp coding downstream 137487 42509769 ~ 42513637 (+)
tpst1l tpst1 coding downstream 156222 42528504 ~ 42545974 (+)
G1293979 NA non-coding upstream 48874 42321591 ~ 42323337 (+)
G1293974 NA non-coding upstream 67658 42304297 ~ 42304553 (+)
G1293798 NA non-coding upstream 115046 42256868 ~ 42257165 (+)
G1293769 NA non-coding upstream 170308 42201430 ~ 42201903 (+)
G1293637 NA non-coding upstream 302262 42069660 ~ 42069949 (+)
G1294052 NA non-coding downstream 77193 42449475 ~ 42449737 (+)
G1294276 NA non-coding downstream 185108 42557390 ~ 42568776 (+)
G1294336 NA non-coding downstream 272732 42645014 ~ 42645230 (+)
G1294325 NA non-coding downstream 311342 42683624 ~ 42684414 (+)
G1294362 NA non-coding downstream 362009 42734291 ~ 42734604 (+)
G1293295 NA other upstream 462600 41909034 ~ 41909611 (+)
G1293072 NA other upstream 784067 41583216 ~ 41589030 (+)
LOC110490048 il-1racp other upstream 2241477 40089464 ~ 40132600 (+)
G1291464 NA other upstream 2304304 40067558 ~ 40067907 (+)
G1290614 NA other upstream 3245202 39126272 ~ 39127009 (+)
G1294319 NA other downstream 392571 42764853 ~ 42767937 (+)
G1295348 LOC106602853 other downstream 1224642 43596924 ~ 43597464 (+)
G1295730 NA other downstream 1543896 43916178 ~ 43916479 (+)
G1295845 NA other downstream 1657154 44029436 ~ 44029861 (+)
cblb cblb other downstream 1949221 44173352 ~ 44326246 (+)
ncbp3 ncbp3 coding downstream 221702 42605307 ~ 42624228 (+)
alg8 alg8 coding downstream 313110 42696715 ~ 42725617 (+)

Expression


trnaa-ugc-118 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

trnaa-ugc-118 Expression in each Bioproject

Bar chart with 17 bars.
trnaa-ugc-118 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network