Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_031581 (MIR199B)

Basic Information

Item	Value
gene id	XLOC_031581
gene name	MIR199B
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007116.7
NCBI id	CM002889.2
chromosome length	72500376
location	63709618 ~ 63709683 (-)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00061181
CCCAGTGTTCAGACTACCTGTTCAGGGCGTAGAGATTGTACAGTAGTCTGCACATTGGTTAGGCTG

Function

symbol	description
mir199b	Predicted to act upstream of or within cellular response to decreased oxygen levels and sensory perception of sound. Biomarker of hepatocellular carcinoma.

GO: NA

KEGG:

id	description
ko05206	MicroRNAs in cancer
ko04147	Exosome
ko03100	Non-coding RNAs

Ensembl:

ensembl_id

ENSDARG00000081800

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00061181	True	66	miRNA	0.50	1	63709618	63709683

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_031580	ciz1b	coding	downstream	45807	63648164 ~ 63663811 (-)
XLOC_031579	surf4l	coding	downstream	64680	63629000 ~ 63644938 (-)
XLOC_031578	prdm12b	coding	downstream	194408	63509761 ~ 63515210 (-)
XLOC_031577	c5	coding	downstream	200037	63458263 ~ 63509581 (-)
XLOC_031576	cntrl	coding	downstream	270901	63400366 ~ 63438717 (-)
XLOC_031582	NA	coding	upstream	24656	63734339 ~ 63749539 (-)
XLOC_031583	NA	coding	upstream	151003	63860686 ~ 63864353 (-)
XLOC_031584	pappab	coding	upstream	203627	63913310 ~ 64104012 (-)
XLOC_031585	AL845507.1	coding	upstream	275761	63985444 ~ 63985560 (-)
XLOC_031586	cmlc1	coding	upstream	457937	64167620 ~ 64168415 (-)
XLOC_031575	NA	non-coding	downstream	321021	63373915 ~ 63388597 (-)
XLOC_031572	NA	non-coding	downstream	386915	63288663 ~ 63322703 (-)
XLOC_031573	NA	non-coding	downstream	403729	63288821 ~ 63305889 (-)
XLOC_031564	NA	non-coding	downstream	985715	62717299 ~ 62723903 (-)
XLOC_031563	NA	non-coding	downstream	1039757	62659842 ~ 62669861 (-)
XLOC_031590	NA	non-coding	upstream	667361	64377044 ~ 64389332 (-)
XLOC_031593	AL929048.1	non-coding	upstream	947045	64656728 ~ 64671562 (-)
XLOC_031562	NA	non-coding	downstream	1001657	62642629 ~ 62707961 (-)

Expression

Co-expression Network