LOC118938967



Basic Information


Item Value
gene id LOC118938967
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 69625000 ~ 69625129 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005036361.1
GCGCATCCTTAGTAAACCCCCTAGTTGCTCATCGTAGCCTCTGGGACAAGGAAGGATGCTAGATCAAACTAGAGATCCAAAGCTGAGAGTCTTGTCCATGTCTCTTGGTTATTTCAGCTCTGGGACAGTT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005036361.1 True 130 mRNA 0.48 1 69625000 69625129
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936535 LOC106597692 coding downstream 10781 69611623 ~ 69614219 (-)
LOC110499763 NA coding downstream 14655 69609745 ~ 69610345 (-)
LOC110511775 LOC106609789 coding downstream 98872 69513903 ~ 69526128 (-)
LOC110500968 LOC106609767 coding downstream 111597 69502537 ~ 69513403 (-)
LOC110499783 LOC106609772 coding downstream 194192 69424840 ~ 69430808 (-)
LOC118938965 NA coding upstream 4529 69629658 ~ 69629794 (-)
LOC110500965 osbpl8 coding upstream 53049 69678178 ~ 69829767 (-)
LOC110499751 csrp2 coding upstream 256095 69881224 ~ 69891087 (-)
LOC110499754 LOC106609744 coding upstream 280292 69905421 ~ 69927631 (-)
LOC110490659 NA coding upstream 768132 70393261 ~ 70394050 (-)
G1322213 NA non-coding downstream 16902 69607345 ~ 69608098 (-)
G1322212 NA non-coding downstream 20244 69604452 ~ 69604756 (-)
G1322211 NA non-coding downstream 21776 69602957 ~ 69603224 (-)
G1322206 NA non-coding downstream 51744 69572489 ~ 69573256 (-)
G1322201 NA non-coding downstream 60294 69564357 ~ 69564706 (-)
G1322237 NA non-coding upstream 20086 69645215 ~ 69645423 (-)
G1322252 NA non-coding upstream 36170 69661299 ~ 69661523 (-)
G1322267 NA non-coding upstream 83585 69708714 ~ 69710973 (-)
G1322286 NA non-coding upstream 164527 69789656 ~ 69790298 (-)
G1322290 NA non-coding upstream 173160 69798289 ~ 69799504 (-)
G1321997 NA other downstream 61960 69562310 ~ 69563040 (-)
G1321729 NA other downstream 401972 69220303 ~ 69223028 (-)
LOC110490790 LOC106609779 other downstream 468001 69149477 ~ 69163694 (-)
G1321652 nrf1 other downstream 551724 69031026 ~ 69073276 (-)
LOC110513021 exoc4 other downstream 1448618 67998532 ~ 68239937 (-)
G1322348 NA other upstream 273556 69897748 ~ 69899703 (-)
G1323036 NA other upstream 911323 70536452 ~ 70537139 (-)
LOC110490645 LOC106576589 other upstream 918227 70543356 ~ 70547418 (-)
G1323207 NA other upstream 1400122 71025251 ~ 71039522 (-)
G1323296 LOC106609674 other upstream 1577371 71202500 ~ 71237846 (-)

Expression


LOC118938967 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

LOC118938967 Expression in each Bioproject

Bar chart with 9 bars.
LOC118938967 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network