G1248493



Basic Information


Item Value
gene id G1248493
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 722555 ~ 722919 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1425804
gtacataggtcatctgtaagtagcccatccaatctaccacatccccatactgtatttatttatttattttgctcctttgcaccccagtatctctacttgcacattcatcttctgcacatcctaccattccagtgtttaattgctatattgtaattactttgccaccatggtctatttattgccttacttctcttatcctacctcatttgcacatgctgtatatagatttctctactgtattattgattgtatgtttgtttattccatgtgtaactctgtgttgttgtatatgttgaactgctttgctttatcttggccaggtcgcagttgcaaatgagaacgtgttctcatctagcctacctggt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1425804 True 365 lncRNA 0.38 1 722555 722919

Neighbor


gene id symbol gene type direction distance location
si:ch211-161h7.4 LOC106590704 coding upstream 167537 507000 ~ 555018 (+)
LOC118938950 NA coding upstream 247984 470671 ~ 474571 (+)
ptchd1 ptchd1 coding upstream 251914 389255 ~ 470641 (+)
phex phex coding upstream 349152 359420 ~ 373403 (+)
mbtps2 mbtps2 coding upstream 371268 280836 ~ 351287 (+)
zbtb47b zbtb47 coding downstream 148289 871208 ~ 1014733 (+)
LOC110490871 LOC106584129 coding downstream 333629 1056548 ~ 1057743 (+)
vill vill coding downstream 407320 1130239 ~ 1193766 (+)
map3k22 LOC106590696 coding downstream 577721 1300640 ~ 1404290 (+)
myd88 myd88 coding downstream 693936 1416855 ~ 1427915 (+)
G1248485 NA non-coding upstream 9984 712224 ~ 712571 (+)
G1248484 NA non-coding upstream 10537 711750 ~ 712018 (+)
G1248476 NA non-coding upstream 24843 697499 ~ 697712 (+)
G1248469 NA non-coding upstream 31962 689866 ~ 690593 (+)
G1248466 NA non-coding upstream 36243 683866 ~ 686312 (+)
G1248509 NA non-coding downstream 41323 764242 ~ 764446 (+)
G1248514 NA non-coding downstream 71544 794463 ~ 794896 (+)
G1248531 sec22c non-coding downstream 103685 826604 ~ 828881 (+)
G1248580 NA non-coding downstream 183040 905959 ~ 906473 (+)
G1248583 NA non-coding downstream 190588 913507 ~ 914780 (+)
G1248124 NA other upstream 616084 79681 ~ 140421 (+)
G1249139 NA other downstream 686586 1409505 ~ 1410999 (+)
G1250120 NA other downstream 1749976 2472895 ~ 2473370 (+)
G1250863 NA other downstream 2630887 3353806 ~ 3354295 (+)
G1250885 NA other downstream 2648277 3371196 ~ 3372193 (+)
LOC110489525 LOC106590672 other downstream 3742857 4465748 ~ 4468522 (+)

Expression


G1248493 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1248493 Expression in each Bioproject

Bar chart with 20 bars.
G1248493 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network