G1249001


Basic Information

Item Value
gene id G1249001
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 905801 ~ 907707 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1426406
CAGTAGAGAAGCTATTCGTCCTCTTGGTTAATTGGAACGGCGTCACAGTAGAGAAGCTATTCATCCTCTTGGTAAATTGGAACTACGTCACAGTAGAGAAGCTATTCATCCTCTTGGTTAATTGGAACAGCGTCACAGTAGAGAAGCTATTCGTCCTCTTGGTTAATTGGAACTACGTCACAGTAGAGAAGCTATTTGTCCTCTTCGTTAATTGGAACTCCATTACAGTAGAGAAGCTATTCATCCTCTTGGTTAATTGGAACTCCATTACAGTAGAGAAGCTATTCGTTCTCTTGTTTAATTGGAACTACGTCACAGCAGAGAAGCTATTCGTCCTCTTGGTTAATTGGAACGGCGTCACAGTAGAGAAGCTATTCGTCCTCTTGGTTAATTGGAACTCCATTACAGTAGAGAAGCTATTCGTCCTCTTGGTTAATTGGAACTCCATCACAGTAGAGAAGCTATTCGTCCTCTTGGTTAATTGGAACGGCGTCACAGTAGAGAAGCTATTCGTCCTCTTGGTTAATTGGAACTCCATCACAGTAGAGAAGCTATTC

Function

NR:

description
PREDICTED: uncharacterized PPE family protein PPE10-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1426406 True 557 lncRNA 0.42 4 905801 907707

Neighbor

gene id symbol gene type direction distance location
sec22c sec22c coding downstream 62198 826598 ~ 843603 (-)
LOC118938951 NA coding downstream 73700 830248 ~ 832327 (-)
vipr1b vipr1 coding downstream 100408 572798 ~ 805393 (-)
smpx smpx coding downstream 658643 211098 ~ 247177 (-)
LOC118938957 NA coding downstream 831809 73839 ~ 73992 (-)
klhl40b LOC106590700 coding upstream 116867 1024574 ~ 1040867 (-)
hhatlb hhatl coding upstream 147256 1054963 ~ 1101022 (-)
LOC118938952 NA coding upstream 153631 1061338 ~ 1062552 (-)
LOC110489513 NA coding upstream 320133 1227840 ~ 1288739 (-)
LOC110489519 LOC106590690 coding upstream 524654 1432361 ~ 1472553 (-)
G1248973 NA non-coding downstream 15428 870779 ~ 890373 (-)
G1248955 NA non-coding downstream 71225 834039 ~ 834576 (-)
G1248939 NA non-coding downstream 109988 795499 ~ 795813 (-)
G1248937 NA non-coding downstream 112145 793392 ~ 793656 (-)
G1248959 NA non-coding upstream 287 907994 ~ 912450 (-)
G1249013 NA non-coding upstream 17613 925320 ~ 925998 (-)
G1249030 NA non-coding upstream 106104 1013811 ~ 1019927 (-)
G1249042 NA non-coding upstream 140826 1048533 ~ 1049103 (-)
G1249043 NA non-coding upstream 145054 1052761 ~ 1053406 (-)
G1249325 NA other upstream 495489 1403196 ~ 1405878 (-)
G1249326 LOC106581475 other upstream 501482 1409189 ~ 1411097 (-)
G1249729 NA other upstream 899277 1806984 ~ 1807621 (-)
G1250031 LOC107579696 other upstream 1439884 2347591 ~ 2348068 (-)
G1250592 NA other upstream 2079407 2987114 ~ 2987410 (-)

Expression

G1249001 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1249001 Expression in each Bioproject

Bar chart with 10 bars.
G1249001 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network