G1249364



Basic Information


Item Value
gene id G1249364
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 1503311 ~ 1503680 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1426937
gagagagagagagaagaaagaaagagagaagagagaaagagaaatagagagagagagagagaaagagagagagatagtgagagagtgagataaagtgtgtgagagagaaagagagaaagatagtgagagagtgagataaagtgtgtgagagagagagtgagataaagtgtgagagagtgagataaagtgtgtgtgagagagagatatgtgtcttctcagtcaggttgagactggtctactaccaggtcatgtgtcttctcagtcaggttgagactggtctactaccaggtcatgtgtcttctcagtcaggttgagactggtctactaccaggtcatgtgtcttctcagtcaggttgagactggtctacta

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1426937 True 370 lncRNA 0.44 1 1503311 1503680
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110489519 LOC106590690 coding downstream 30758 1432361 ~ 1472553 (-)
LOC110489513 NA coding downstream 214572 1227840 ~ 1288739 (-)
hhatlb hhatl coding downstream 402289 1054963 ~ 1101022 (-)
LOC118938952 NA coding downstream 440759 1061338 ~ 1062552 (-)
klhl40b LOC106590700 coding downstream 462444 1024574 ~ 1040867 (-)
LOC110490875 LOC106590692 coding upstream 29410 1533090 ~ 1601607 (-)
LOC118938935 NA coding upstream 110365 1614045 ~ 1693432 (-)
LOC110489515 glyg coding upstream 354850 1858530 ~ 1895147 (-)
cpb1 cbpb1 coding upstream 526921 2030601 ~ 2053510 (-)
LOC110490877 LOC106579762 coding upstream 560311 2063991 ~ 2068224 (-)
G1249346 NA non-coding downstream 34100 1468301 ~ 1469211 (-)
G1249338 NA non-coding downstream 47855 1454711 ~ 1455456 (-)
G1249312 NA non-coding downstream 74717 1426927 ~ 1428594 (-)
G1249328 NA non-coding downstream 90878 1412043 ~ 1412433 (-)
G1249327 NA non-coding downstream 91557 1411535 ~ 1411754 (-)
G1249366 NA non-coding upstream 255 1503935 ~ 1504136 (-)
G1249367 NA non-coding upstream 1166 1504846 ~ 1505085 (-)
G1249370 NA non-coding upstream 8796 1512476 ~ 1512754 (-)
G1249371 NA non-coding upstream 9245 1512925 ~ 1513621 (-)
G1249374 NA non-coding upstream 13498 1517178 ~ 1517919 (-)
G1249326 LOC106581475 other downstream 92368 1409189 ~ 1411097 (-)
G1249325 NA other downstream 97433 1403196 ~ 1405878 (-)
smpx smpx other downstream 1256134 211098 ~ 247177 (-)
G1249729 NA other upstream 303304 1806984 ~ 1807621 (-)
G1250031 LOC107579696 other upstream 843911 2347591 ~ 2348068 (-)
G1250592 NA other upstream 1483434 2987114 ~ 2987410 (-)
dipk2ab LOC106590677 other upstream 2436185 3870649 ~ 3976512 (-)
G1251965 rpl7 other upstream 3278960 4782640 ~ 4788427 (-)

Expression


G1249364 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1249364 Expression in each Bioproject

Bar chart with 17 bars.
G1249364 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network