G1249988



Basic Information


Item Value
gene id G1249988
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 2296872 ~ 2297104 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1427792
AACCTTCTCTCATCATACTACTGGAAAATCAACCTTCTCTCGTCATACTACTGGAACATCAACCTTCTCTCATCATACTACTGGAACATCAACCTTCTCTCATCATACTACTGGAACATCAACCTACTGAAACATCTACCTTCTCTCATCATACTACTGGAACATCAACCTACTGAAACATCTACCTTCTCTCATCATACTACTGGAACATCAACCTACTGAAACATCTACCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1427792 True 233 lncRNA 0.39 1 2296872 2297104

Neighbor


gene id symbol gene type direction distance location
LOC110490877 LOC106579762 coding downstream 228648 2063991 ~ 2068224 (-)
cpb1 cbpb1 coding downstream 243362 2030601 ~ 2053510 (-)
LOC110489515 glyg coding downstream 401725 1858530 ~ 1895147 (-)
LOC118938935 NA coding downstream 603440 1614045 ~ 1693432 (-)
LOC110490875 LOC106590692 coding downstream 695265 1533090 ~ 1601607 (-)
zic1 LOC100136467 coding upstream 158819 2455923 ~ 2460981 (-)
dipk2ab LOC106590677 coding upstream 1573545 3870649 ~ 3976512 (-)
LOC110512106 LOC106590676 coding upstream 1735124 4032228 ~ 4101181 (-)
LOC110490880 LOC106590674 coding upstream 1857148 4154252 ~ 4167691 (-)
LOC118938936 NA coding upstream 2271425 4568529 ~ 4570176 (-)
G1249961 NA non-coding downstream 24169 2272472 ~ 2272703 (-)
G1249960 NA non-coding downstream 26246 2270277 ~ 2270626 (-)
G1249959 NA non-coding downstream 26660 2270008 ~ 2270212 (-)
G1249958 NA non-coding downstream 26921 2269563 ~ 2269951 (-)
G1249957 NA non-coding downstream 27351 2269284 ~ 2269521 (-)
G1249991 NA non-coding upstream 3569 2300673 ~ 2300915 (-)
G1249994 NA non-coding upstream 5704 2302808 ~ 2303023 (-)
G1249995 NA non-coding upstream 6995 2304099 ~ 2304580 (-)
G1250011 NA non-coding upstream 17385 2314489 ~ 2316999 (-)
G1250019 NA non-coding upstream 32323 2329427 ~ 2330004 (-)
G1249729 NA other downstream 489251 1806984 ~ 1807621 (-)
G1249326 LOC106581475 other downstream 885929 1409189 ~ 1411097 (-)
G1249325 NA other downstream 890994 1403196 ~ 1405878 (-)
smpx smpx other downstream 2049695 211098 ~ 247177 (-)
G1250031 LOC107579696 other upstream 50487 2347591 ~ 2348068 (-)
G1250592 NA other upstream 690010 2987114 ~ 2987410 (-)
G1251965 rpl7 other upstream 2485536 4782640 ~ 4788427 (-)
G1252027 NA other upstream 2542280 4839384 ~ 4839879 (-)

Expression


G1249988 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1249988 Expression in each Bioproject

Bar chart with 4 bars.
G1249988 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network