G1249991



Basic Information


Item Value
gene id G1249991
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 2300673 ~ 2300915 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1427795
gactcacagctcttagagactcacccagaaagactcacagctcttagagactcacccagaaagactcacagctcttagagacatacccagaaagactcacagctcttagagactcacccagaaagactcacagctcttagagacttacccagaaagactcacagctcttagagacttacccagaaagactcacagctcttagagacttacccagaaagactcacagctcttaaagacttaccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1427795 True 243 lncRNA 0.47 1 2300673 2300915

Neighbor


gene id symbol gene type direction distance location
LOC110490877 LOC106579762 coding downstream 232449 2063991 ~ 2068224 (-)
cpb1 cbpb1 coding downstream 247163 2030601 ~ 2053510 (-)
LOC110489515 glyg coding downstream 405526 1858530 ~ 1895147 (-)
LOC118938935 NA coding downstream 607241 1614045 ~ 1693432 (-)
LOC110490875 LOC106590692 coding downstream 699066 1533090 ~ 1601607 (-)
zic1 LOC100136467 coding upstream 155008 2455923 ~ 2460981 (-)
dipk2ab LOC106590677 coding upstream 1569734 3870649 ~ 3976512 (-)
LOC110512106 LOC106590676 coding upstream 1731313 4032228 ~ 4101181 (-)
LOC110490880 LOC106590674 coding upstream 1853337 4154252 ~ 4167691 (-)
LOC118938936 NA coding upstream 2267614 4568529 ~ 4570176 (-)
G1249988 NA non-coding downstream 3569 2296872 ~ 2297104 (-)
G1249961 NA non-coding downstream 27970 2272472 ~ 2272703 (-)
G1249960 NA non-coding downstream 30047 2270277 ~ 2270626 (-)
G1249959 NA non-coding downstream 30461 2270008 ~ 2270212 (-)
G1249958 NA non-coding downstream 30722 2269563 ~ 2269951 (-)
G1249994 NA non-coding upstream 1893 2302808 ~ 2303023 (-)
G1249995 NA non-coding upstream 3184 2304099 ~ 2304580 (-)
G1250011 NA non-coding upstream 13574 2314489 ~ 2316999 (-)
G1250019 NA non-coding upstream 28512 2329427 ~ 2330004 (-)
G1250024 NA non-coding upstream 36186 2337101 ~ 2337322 (-)
G1249729 NA other downstream 493052 1806984 ~ 1807621 (-)
G1249326 LOC106581475 other downstream 889730 1409189 ~ 1411097 (-)
G1249325 NA other downstream 894795 1403196 ~ 1405878 (-)
smpx smpx other downstream 2053496 211098 ~ 247177 (-)
G1250031 LOC107579696 other upstream 46676 2347591 ~ 2348068 (-)
G1250592 NA other upstream 686199 2987114 ~ 2987410 (-)
G1251965 rpl7 other upstream 2481725 4782640 ~ 4788427 (-)
G1252027 NA other upstream 2538469 4839384 ~ 4839879 (-)

Expression


G1249991 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1249991 Expression in each Bioproject

Bar chart with 21 bars.
G1249991 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network