G1251209



Basic Information


Item Value
gene id G1251209
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 3865941 ~ 3866497 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1429269
TCACACTGAGGTTTAGTGATTCTCACACTGAGGTTTAGTGATTCTCACACTGAGGTTTAGTGATTCTCACACTGAGGTTTAGTGATTCTCACACTGAGGTTTAGTGATTATCACACTGAGGTTTAGTGATTCTCACACTGAGGTTTAGTGATTATCACACTGAGGTTTAGTGATTCTCACACTGAGGTTTAGTGATTCTCACACTGAGGTTTAATGATTCTCACACTGAGGTTTAGTGATTATCACACTGAGGTTTAGTGATTATCACACTGGGGTTGAGTGGTTATCACAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1429269 True 292 lncRNA 0.40 2 3865941 3866497
Loading

Neighbor


gene id symbol gene type direction distance location
zic1 LOC100136467 coding downstream 1404960 2455923 ~ 2460981 (-)
LOC110490877 LOC106579762 coding downstream 1797717 2063991 ~ 2068224 (-)
cpb1 cbpb1 coding downstream 1812431 2030601 ~ 2053510 (-)
LOC110489515 glyg coding downstream 1970794 1858530 ~ 1895147 (-)
LOC118938935 NA coding downstream 2172509 1614045 ~ 1693432 (-)
dipk2ab LOC106590677 coding upstream 4152 3870649 ~ 3976512 (-)
LOC110512106 LOC106590676 coding upstream 165731 4032228 ~ 4101181 (-)
LOC110490880 LOC106590674 coding upstream 287755 4154252 ~ 4167691 (-)
LOC118938936 NA coding upstream 702032 4568529 ~ 4570176 (-)
LOC110490881 LOC106590669 coding upstream 875183 4741680 ~ 4769343 (-)
G1251200 NA non-coding downstream 11466 3854254 ~ 3854475 (-)
G1251196 NA non-coding downstream 84574 3781003 ~ 3781367 (-)
G1251195 NA non-coding downstream 85072 3780523 ~ 3780869 (-)
G1251183 NA non-coding downstream 95968 3768668 ~ 3769973 (-)
G1251168 NA non-coding downstream 109259 3756391 ~ 3756682 (-)
G1251215 NA non-coding upstream 2889 3869386 ~ 3869917 (-)
G1251329 LOC106590678 non-coding upstream 11656 3878153 ~ 3878478 (-)
G1251344 NA non-coding upstream 51186 3917683 ~ 3920080 (-)
G1251361 NA non-coding upstream 92830 3959327 ~ 3959883 (-)
G1250592 NA other downstream 878531 2987114 ~ 2987410 (-)
G1250031 LOC107579696 other downstream 1517873 2347591 ~ 2348068 (-)
G1249729 NA other downstream 2058320 1806984 ~ 1807621 (-)
G1249326 LOC106581475 other downstream 2454998 1409189 ~ 1411097 (-)
G1249325 NA other downstream 2460063 1403196 ~ 1405878 (-)
G1251965 rpl7 other upstream 916143 4782640 ~ 4788427 (-)
G1252027 NA other upstream 972887 4839384 ~ 4839879 (-)
LOC110490882 LOC107696012 other upstream 1029125 4894083 ~ 5003661 (-)
G1253229 NA other upstream 2540574 6407071 ~ 6407289 (-)

Expression


G1251209 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1251209 Expression in each Bioproject

Bar chart with 11 bars.
G1251209 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network